EMAIL THIS PAGE TO A FRIEND

NME1

NME/NM23 nucleoside diphosphate kinase 1

81 Gene Product Result for
Synonyms: AWD GAAD NB NBS NDKA NDPK-A NDPKA NM23 NM23-H1
UniProtKB ID: P15531, Q6FGK3, Q86XQ2, Q9UDJ6
Gene ID:
Human(4830) Summary: This gene (NME1) was identified because of its reduced mRNA transcript levels in highly metastatic cells. Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by this gene) and 'B' (encoded by NME2) isoforms. Mutations in this gene have been identified in aggressive neuroblastomas. Two transcript variants encoding different isoforms have been found for this gene. Co-transcription of this gene and the neighboring downstream gene (NME2) generates naturally-occurring transcripts (NME1-NME2), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Jul 2008]
Mouse(18102) NME/NM23 nucleoside diphosphate kinase 1
Rat(191575) NME/NM23 nucleoside diphosphate kinase 1
chicken(422094) non-metastatic cells 1, protein (NM23A) expressed in
dog(480558) non-metastatic cells 1, protein (NM23A) expressed in
cow(404189) non-metastatic cells 1, protein (NM23A) expressed in
Horse(100533966) NME/NM23 nucleoside diphosphate kinase 1
dog(476767) non-metastatic cells 1, protein (NM23A) expressed in
domestic guinea pig(100379567) NME/NM23 nucleoside diphosphate kinase 1
Domestic Rabbit(100533971) NME/NM23 nucleoside diphosphate kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000269 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU048121 MISSION® esiRNA esiRNA targeting mouse Nme1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000269 siRNAs that have been validated in the lab human pricing
NM_198175 siRNAs that have been validated in the lab human pricing
NM_138548 Rosetta Predictions rat pricing
NM_008704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000269 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000012 validated 630
1 SASI_Hs01_00050683 validated 539
1 SASI_WI_00000011 validated 575
1 SASI_Hs01_00050682 validated 431
1 SASI_WI_00000010 validated 647
1 SASI_Hs01_00050684 validated 490
2 SASI_Hs01_00050685 predicted 425
3 SASI_Hs01_00050686 predicted 436
4 SASI_Hs01_00050687 predicted 412
5 SASI_Hs01_00050688 predicted 411
6 SASI_Hs01_00050689 predicted 452
7 SASI_Hs01_00050690 predicted 540
8 SASI_Hs01_00050691 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198175 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162418 validated 705
2 SASI_Hs01_00162416 predicted 653
3 SASI_Hs01_00162417 predicted 760
4 SASI_Hs01_00162419 predicted 653
5 SASI_Hs01_00162420 predicted 654
6 SASI_Hs01_00162421 predicted 641
7 SASI_Hs01_00162422 predicted 628
8 SASI_Hs01_00162423 predicted 669
9 SASI_Hs01_00162424 predicted 758
10 SASI_Hs01_00162425 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094420 predicted 201
2 SASI_Rn01_00094421 predicted 231
3 SASI_Rn01_00094422 predicted 233
4 SASI_Rn01_00094423 predicted 398
5 SASI_Rn01_00094424 predicted 490
6 SASI_Rn01_00094425 predicted 212
7 SASI_Rn02_00268188 predicted 342
8 SASI_Rn01_00094427 predicted 200
9 SASI_Rn01_00094429 predicted 415
10 SASI_Rn02_00268189 predicted 308
11 SASI_Rn01_00094426 predicted 405
12 SASI_Rn01_00094428 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030933 predicted 736
2 SASI_Mm02_00314521 predicted 401
3 SASI_Mm01_00030936 predicted 888
4 SASI_Mm01_00030937 predicted 673
5 SASI_Mm02_00314522 predicted 812
6 SASI_Mm02_00314523 predicted 975
7 SASI_Mm01_00030938 predicted 494
8 SASI_Mm01_00030939 predicted 310
9 SASI_Mm02_00314524 predicted 981
10 SASI_Mm02_00314525 predicted 915
11 SASI_Mm01_00030934 predicted 982
12 SASI_Mm01_00030935 predicted 594
13 SASI_Mm01_00030940 predicted 692
14 SASI_Mm01_00030941 predicted 858
15 SASI_Mm01_00030942 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008704
VALIDATED
NME1 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 nucleoside diphosphate kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008704.2-493s1c1
Sequence:CCGGGCCTGGTGAAATACATGCACTCTCGAGAGTGCATGTATTTCACCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008704.2-821s1c1
Sequence:CCGGCAACCCTAGATATTTCTGGAACTCGAGTTCCAGAAATATCTAGGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008704.2-415s1c1
Sequence:CCGGGTCTGAAGTTTCTGCAGGCTTCTCGAGAAGCCTGCAGAAACTTCAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008704.2-665s1c1
Sequence:CCGGCGATTCTGTAAAGAGCGCAGACTCGAGTCTGCGCTCTTTACAGAATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-513s21c1
Sequence:CCGGTCAGGACCAGTGGTTGCTATGCTCGAGCATAGCAACCACTGGTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-894s21c1
Sequence:CCGGACGTGCCACTGTTAGATTAAACTCGAGTTTAATCTAACAGTGGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-739s21c1
Sequence:CCGGGTGCGCAGAACTGGATCTATGCTCGAGCATAGATCCAGTTCTGCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-485s21c1
Sequence:CCGGCTTTACTGGCCTGGTGAAATACTCGAGTATTTCACCAGGCCAGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-813s21c1
Sequence:CCGGGGGACCAGCAACCCTAGATATCTCGAGATATCTAGGGTTGCTGGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008704
VALIDATED
NME1 MISSION shRNA shRNA Plasmid DNA
NME/NM23 nucleoside diphosphate kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008704.2-493s1c1
Sequence:CCGGGCCTGGTGAAATACATGCACTCTCGAGAGTGCATGTATTTCACCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008704.2-821s1c1
Sequence:CCGGCAACCCTAGATATTTCTGGAACTCGAGTTCCAGAAATATCTAGGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008704.2-415s1c1
Sequence:CCGGGTCTGAAGTTTCTGCAGGCTTCTCGAGAAGCCTGCAGAAACTTCAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008704.2-665s1c1
Sequence:CCGGCGATTCTGTAAAGAGCGCAGACTCGAGTCTGCGCTCTTTACAGAATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-513s21c1
Sequence:CCGGTCAGGACCAGTGGTTGCTATGCTCGAGCATAGCAACCACTGGTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-894s21c1
Sequence:CCGGACGTGCCACTGTTAGATTAAACTCGAGTTTAATCTAACAGTGGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-739s21c1
Sequence:CCGGGTGCGCAGAACTGGATCTATGCTCGAGCATAGATCCAGTTCTGCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-485s21c1
Sequence:CCGGCTTTACTGGCCTGGTGAAATACTCGAGTATTTCACCAGGCCAGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-813s21c1
Sequence:CCGGGGGACCAGCAACCCTAGATATCTCGAGATATCTAGGGTTGCTGGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008704
VALIDATED
NME1 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 nucleoside diphosphate kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008704.2-493s1c1
Sequence:CCGGGCCTGGTGAAATACATGCACTCTCGAGAGTGCATGTATTTCACCAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008704.2-821s1c1
Sequence:CCGGCAACCCTAGATATTTCTGGAACTCGAGTTCCAGAAATATCTAGGGTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008704.2-415s1c1
Sequence:CCGGGTCTGAAGTTTCTGCAGGCTTCTCGAGAAGCCTGCAGAAACTTCAGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008704.2-665s1c1
Sequence:CCGGCGATTCTGTAAAGAGCGCAGACTCGAGTCTGCGCTCTTTACAGAATCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-513s21c1
Sequence:CCGGTCAGGACCAGTGGTTGCTATGCTCGAGCATAGCAACCACTGGTCCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-894s21c1
Sequence:CCGGACGTGCCACTGTTAGATTAAACTCGAGTTTAATCTAACAGTGGCACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-739s21c1
Sequence:CCGGGTGCGCAGAACTGGATCTATGCTCGAGCATAGATCCAGTTCTGCGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-485s21c1
Sequence:CCGGCTTTACTGGCCTGGTGAAATACTCGAGTATTTCACCAGGCCAGTAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008704.2-813s21c1
Sequence:CCGGGGGACCAGCAACCCTAGATATCTCGAGATATCTAGGGTTGCTGGTCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000269
VALIDATED
NME1 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 nucleoside diphosphate kinase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-183s1c1
Sequence:CCGGCCGCCTTGTTGGTCTGAAATTCTCGAGAATTTCAGACCAACAAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-270s1c1
Sequence:CCGGCGGCCTGGTGAAATACATGCACTCGAGTGCATGTATTTCACCAGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010055    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-99s1c1
Sequence:CCGGGCGTACCTTCATTGCGATCAACTCGAGTTGATCGCAATGAAGGTACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000269.2-250s1c1
Sequence:CCGGCTCAAGGAACACTACGTTGACCTCGAGGTCAACGTAGTGTTCCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-182s1c1
Sequence:CCGGTCCGCCTTGTTGGTCTGAAATCTCGAGATTTCAGACCAACAAGGCGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000269.2-544s1c1
Sequence:CCGGGCTCAGAACTGGATCTATGAACTCGAGTTCATAGATCCAGTTCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000269.2-644s1c1
Sequence:CCGGCTAGTTATTTACAGGAACTTCCTCGAGGAAGTTCCTGTAAATAACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000269.2-500s1c1
Sequence:CCGGGCTTGTGGTTTCACCCTGAGGCTCGAGCCTCAGGGTGAAACCACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000269
VALIDATED
NME1 MISSION shRNA shRNA Plasmid DNA
NME/NM23 nucleoside diphosphate kinase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-183s1c1
Sequence:CCGGCCGCCTTGTTGGTCTGAAATTCTCGAGAATTTCAGACCAACAAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-270s1c1
Sequence:CCGGCGGCCTGGTGAAATACATGCACTCGAGTGCATGTATTTCACCAGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010055    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-99s1c1
Sequence:CCGGGCGTACCTTCATTGCGATCAACTCGAGTTGATCGCAATGAAGGTACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000269.2-250s1c1
Sequence:CCGGCTCAAGGAACACTACGTTGACCTCGAGGTCAACGTAGTGTTCCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-182s1c1
Sequence:CCGGTCCGCCTTGTTGGTCTGAAATCTCGAGATTTCAGACCAACAAGGCGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000269.2-544s1c1
Sequence:CCGGGCTCAGAACTGGATCTATGAACTCGAGTTCATAGATCCAGTTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000269.2-644s1c1
Sequence:CCGGCTAGTTATTTACAGGAACTTCCTCGAGGAAGTTCCTGTAAATAACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000269.2-500s1c1
Sequence:CCGGGCTTGTGGTTTCACCCTGAGGCTCGAGCCTCAGGGTGAAACCACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000269
VALIDATED
NME1 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 nucleoside diphosphate kinase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-183s1c1
Sequence:CCGGCCGCCTTGTTGGTCTGAAATTCTCGAGAATTTCAGACCAACAAGGCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-270s1c1
Sequence:CCGGCGGCCTGGTGAAATACATGCACTCGAGTGCATGTATTTCACCAGGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010055    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-99s1c1
Sequence:CCGGGCGTACCTTCATTGCGATCAACTCGAGTTGATCGCAATGAAGGTACGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000269.2-250s1c1
Sequence:CCGGCTCAAGGAACACTACGTTGACCTCGAGGTCAACGTAGTGTTCCTTGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000269.x-182s1c1
Sequence:CCGGTCCGCCTTGTTGGTCTGAAATCTCGAGATTTCAGACCAACAAGGCGGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000269.2-544s1c1
Sequence:CCGGGCTCAGAACTGGATCTATGAACTCGAGTTCATAGATCCAGTTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000269.2-644s1c1
Sequence:CCGGCTAGTTATTTACAGGAACTTCCTCGAGGAAGTTCCTGTAAATAACTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000269.2-500s1c1
Sequence:CCGGGCTTGTGGTTTCACCCTGAGGCTCGAGCCTCAGGGTGAAACCACAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)