EMAIL THIS PAGE TO A FRIEND

NME2

NME/NM23 nucleoside diphosphate kinase 2

77 Gene Product Result for
Synonyms: NDKB NDPK-B NDPKB NM23-H2 NM23B PUF
UniProtKB ID: P22392, A8MWA3, Q1WM23, Q6LCT6
Gene ID:
Human(4831) Summary: Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by NME1) and 'B' (encoded by this gene) isoforms. Multiple alternatively spliced transcript variants have been found for this gene. Read-through transcription from the neighboring upstream gene (NME1) generates naturally-occurring transcripts (NME1-NME2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Nov 2010]
Mouse(18103) NME/NM23 nucleoside diphosphate kinase 2
Rat(83782) NME/NM23 nucleoside diphosphate kinase 2
chicken(395916) NME/NM23 nucleoside diphosphate kinase 2
dog(480559) non-metastatic cells 2, protein (NM23B) expressed in
cow(615447) non-metastatic cells 2, protein (NM23B) expressed in
Horse(100533967) NME/NM23 nucleoside diphosphate kinase 2
sheep(101102072) NME/NM23 nucleoside diphosphate kinase 2
Domestic Rabbit(100533972) NME/NM23 nucleoside diphosphate kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002512 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU205321 MISSION® esiRNA esiRNA targeting mouse Nme2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018137 siRNAs that have been validated in the lab human pricing
NM_001018138 siRNAs that have been validated in the lab human pricing
NM_001018139 siRNAs that have been validated in the lab human pricing
NM_002512 siRNAs that have been validated in the lab human pricing
NM_031833 Rosetta Predictions rat pricing
NM_001077529 Rosetta Predictions mouse pricing
NM_008705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018137 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068611 validated 426
2 SASI_Hs01_00068612 predicted 367
3 SASI_Hs01_00068613 predicted 498
4 SASI_Hs01_00068609 predicted 495
5 SASI_Hs01_00068614 predicted 480
6 SASI_Hs01_00068615 predicted 488
7 SASI_Hs01_00068610 predicted 500
8 SASI_Hs01_00068616 predicted 446
9 SASI_Hs01_00068617 predicted 425
10 SASI_Hs01_00068618 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018138 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205707 validated 383
2 SASI_Hs01_00205708 predicted 321
3 SASI_Hs01_00205709 predicted 446
4 SASI_Hs01_00205705 predicted 448
5 SASI_Hs01_00205710 predicted 434
6 SASI_Hs01_00205711 predicted 442
7 SASI_Hs01_00205706 predicted 455
8 SASI_Hs01_00205712 predicted 395
9 SASI_Hs01_00205713 predicted 379
10 SASI_Hs01_00205714 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018139 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159745 validated 323
2 SASI_Hs01_00159746 predicted 257
3 SASI_Hs01_00159747 predicted 391
4 SASI_Hs01_00159743 predicted 393
5 SASI_Hs01_00159748 predicted 372
6 SASI_Hs01_00159749 predicted 378
7 SASI_Hs01_00159744 predicted 390
8 SASI_Hs01_00159750 predicted 336
9 SASI_Hs01_00159751 predicted 321
10 SASI_Hs01_00159752 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002512 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037201 validated 493
2 SASI_Hs01_00037202 predicted 429
3 SASI_Hs01_00037203 predicted 567
4 SASI_Hs01_00037199 predicted 568
5 SASI_Hs01_00037204 predicted 548
6 SASI_Hs01_00037205 predicted 561
7 SASI_Hs01_00037200 predicted 571
8 SASI_Hs01_00037206 predicted 508
9 SASI_Hs01_00037207 predicted 500
10 SASI_Hs01_00037208 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058580 predicted 447
2 SASI_Rn01_00058581 predicted 451
3 SASI_Rn01_00058584 predicted 510
4 SASI_Rn01_00058589 predicted 627
5 SASI_Rn02_00265313 predicted 615
6 SASI_Rn01_00058582 predicted 307
7 SASI_Rn01_00058583 predicted 293
8 SASI_Rn01_00058585 predicted 329
9 SASI_Rn01_00058586 predicted 451
10 SASI_Rn01_00058587 predicted 309
11 SASI_Rn01_00058588 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292772 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146112 predicted 568
2 SASI_Mm01_00146111 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002512
NME2 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 nucleoside diphosphate kinase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-504s21c1
Sequence:GTACCGGACCAATCCAGCAGATTCAAAGCTCGAGCTTTGAATCTGCTGGATTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-573s21c1
Sequence:GTACCGGATTCATGGCAGTGATTCAGTACTCGAGTACTGAATCACTGCCATGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-373s21c1
Sequence:CCGGAGCACTACATTGACCTGAAAGCTCGAGCTTTCAGGTCAATGTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-660s21c1
Sequence:CCGGGCTCATGACTGGGTCTATGAACTCGAGTTCATAGACCCAGTCATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-631s1c1
Sequence:CCGGCTGAAGAACTGGTTGACTACACTCGAGTGTAGTCAACCAGTTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-609s1c1
Sequence:CCGGGAAATCAGCCTATGGTTTAAGCTCGAGCTTAAACCATAGGCTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-660s1c1
Sequence:CCGGGCTCATGACTGGGTCTATGAACTCGAGTTCATAGACCCAGTCATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-312s1c1
Sequence:CCGGCAGAAGGGATTCCGCCTCGTGCTCGAGCACGAGGCGGAATCCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-543s1c1
Sequence:CCGGGACTTCTGCATTCAGGTTGGCCTCGAGGCCAACCTGAATGCAGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-609s21c1
Sequence:CCGGGAAATCAGCCTATGGTTTAAGCTCGAGCTTAAACCATAGGCTGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-543s21c1
Sequence:CCGGGACTTCTGCATTCAGGTTGGCCTCGAGGCCAACCTGAATGCAGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.x-221s1c1
Sequence:CCGGAGCACTACATTGACCTGAAAGCTCGAGCTTTCAGGTCAATGTAGTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.x-472s1c1
Sequence:CCGGTTTAAGCCTGAAGAACTGGTTCTCGAGAACCAGTTCTTCAGGCTTAAATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002512
NME2 MISSION shRNA shRNA Plasmid DNA
NME/NM23 nucleoside diphosphate kinase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-504s21c1
Sequence:GTACCGGACCAATCCAGCAGATTCAAAGCTCGAGCTTTGAATCTGCTGGATTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-573s21c1
Sequence:GTACCGGATTCATGGCAGTGATTCAGTACTCGAGTACTGAATCACTGCCATGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-373s21c1
Sequence:CCGGAGCACTACATTGACCTGAAAGCTCGAGCTTTCAGGTCAATGTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-660s21c1
Sequence:CCGGGCTCATGACTGGGTCTATGAACTCGAGTTCATAGACCCAGTCATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-631s1c1
Sequence:CCGGCTGAAGAACTGGTTGACTACACTCGAGTGTAGTCAACCAGTTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-609s1c1
Sequence:CCGGGAAATCAGCCTATGGTTTAAGCTCGAGCTTAAACCATAGGCTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-660s1c1
Sequence:CCGGGCTCATGACTGGGTCTATGAACTCGAGTTCATAGACCCAGTCATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-312s1c1
Sequence:CCGGCAGAAGGGATTCCGCCTCGTGCTCGAGCACGAGGCGGAATCCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-543s1c1
Sequence:CCGGGACTTCTGCATTCAGGTTGGCCTCGAGGCCAACCTGAATGCAGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-609s21c1
Sequence:CCGGGAAATCAGCCTATGGTTTAAGCTCGAGCTTAAACCATAGGCTGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-543s21c1
Sequence:CCGGGACTTCTGCATTCAGGTTGGCCTCGAGGCCAACCTGAATGCAGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.x-221s1c1
Sequence:CCGGAGCACTACATTGACCTGAAAGCTCGAGCTTTCAGGTCAATGTAGTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.x-472s1c1
Sequence:CCGGTTTAAGCCTGAAGAACTGGTTCTCGAGAACCAGTTCTTCAGGCTTAAATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002512
NME2 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 nucleoside diphosphate kinase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-504s21c1
Sequence:GTACCGGACCAATCCAGCAGATTCAAAGCTCGAGCTTTGAATCTGCTGGATTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-573s21c1
Sequence:GTACCGGATTCATGGCAGTGATTCAGTACTCGAGTACTGAATCACTGCCATGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-373s21c1
Sequence:CCGGAGCACTACATTGACCTGAAAGCTCGAGCTTTCAGGTCAATGTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-660s21c1
Sequence:CCGGGCTCATGACTGGGTCTATGAACTCGAGTTCATAGACCCAGTCATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-631s1c1
Sequence:CCGGCTGAAGAACTGGTTGACTACACTCGAGTGTAGTCAACCAGTTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-609s1c1
Sequence:CCGGGAAATCAGCCTATGGTTTAAGCTCGAGCTTAAACCATAGGCTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-660s1c1
Sequence:CCGGGCTCATGACTGGGTCTATGAACTCGAGTTCATAGACCCAGTCATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-312s1c1
Sequence:CCGGCAGAAGGGATTCCGCCTCGTGCTCGAGCACGAGGCGGAATCCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.2-543s1c1
Sequence:CCGGGACTTCTGCATTCAGGTTGGCCTCGAGGCCAACCTGAATGCAGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-609s21c1
Sequence:CCGGGAAATCAGCCTATGGTTTAAGCTCGAGCTTAAACCATAGGCTGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002512.2-543s21c1
Sequence:CCGGGACTTCTGCATTCAGGTTGGCCTCGAGGCCAACCTGAATGCAGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.x-221s1c1
Sequence:CCGGAGCACTACATTGACCTGAAAGCTCGAGCTTTCAGGTCAATGTAGTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002512.x-472s1c1
Sequence:CCGGTTTAAGCCTGAAGAACTGGTTCTCGAGAACCAGTTCTTCAGGCTTAAATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008705
VALIDATED
NME2 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 nucleoside diphosphate kinase 2
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-252s21c1
Sequence:CCGGCGAGATCATCAAACGGTTCGACTCGAGTCGAACCGTTTGATGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-321s21c1
Sequence:CCGGAGAACACCTGAAGCAGCATTACTCGAGTAATGCTGCTTCAGGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-520s21c1
Sequence:CCGGGTTGGCAGGAACATCATTCATCTCGAGATGAATGATGTTCCTGCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-464s21c1
Sequence:CCGGAGACCAATCCAGCTGATTCAACTCGAGTTGAATCAGCTGGATTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-512s1c1
Sequence:CCGGGCATTCAAGTTGGCAGGAACACTCGAGTGTTCCTGCCAACTTGAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-252s1c1
Sequence:CCGGCGAGATCATCAAACGGTTCGACTCGAGTCGAACCGTTTGATGATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-580s1c1
Sequence:CCGGCTGTGGTTTAAGCCCGAAGAACTCGAGTTCTTCGGGCTTAAACCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-594s1c1
Sequence:CCGGCGAAGAACTGATCGACTACAACTCGAGTTGTAGTCGATCAGTTCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-520s1c1
Sequence:CCGGGTTGGCAGGAACATCATTCATCTCGAGATGAATGATGTTCCTGCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-321s1c1
Sequence:CCGGAGAACACCTGAAGCAGCATTACTCGAGTAATGCTGCTTCAGGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-464s1c1
Sequence:CCGGAGACCAATCCAGCTGATTCAACTCGAGTTGAATCAGCTGGATTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008705.3-607s1c1
Sequence:CCGGGACTACAAGTCTTGTGCCCATCTCGAGATGGGCACAAGACTTGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-559s1c1
Sequence:CCGGAGTGCTGAGAAAGAGATCCATCTCGAGATGGATCTCTTTCTCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-530s1c1
Sequence:CCGGACATCATTCATGGCAGTGATTCTCGAGAATCACTGCCATGAATGATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-559s21c1
Sequence:CCGGAGTGCTGAGAAAGAGATCCATCTCGAGATGGATCTCTTTCTCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-594s21c1
Sequence:CCGGCGAAGAACTGATCGACTACAACTCGAGTTGTAGTCGATCAGTTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008705
VALIDATED
NME2 MISSION shRNA shRNA Plasmid DNA
NME/NM23 nucleoside diphosphate kinase 2
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-252s21c1
Sequence:CCGGCGAGATCATCAAACGGTTCGACTCGAGTCGAACCGTTTGATGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-321s21c1
Sequence:CCGGAGAACACCTGAAGCAGCATTACTCGAGTAATGCTGCTTCAGGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-520s21c1
Sequence:CCGGGTTGGCAGGAACATCATTCATCTCGAGATGAATGATGTTCCTGCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-464s21c1
Sequence:CCGGAGACCAATCCAGCTGATTCAACTCGAGTTGAATCAGCTGGATTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-512s1c1
Sequence:CCGGGCATTCAAGTTGGCAGGAACACTCGAGTGTTCCTGCCAACTTGAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-252s1c1
Sequence:CCGGCGAGATCATCAAACGGTTCGACTCGAGTCGAACCGTTTGATGATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-580s1c1
Sequence:CCGGCTGTGGTTTAAGCCCGAAGAACTCGAGTTCTTCGGGCTTAAACCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-594s1c1
Sequence:CCGGCGAAGAACTGATCGACTACAACTCGAGTTGTAGTCGATCAGTTCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-520s1c1
Sequence:CCGGGTTGGCAGGAACATCATTCATCTCGAGATGAATGATGTTCCTGCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-321s1c1
Sequence:CCGGAGAACACCTGAAGCAGCATTACTCGAGTAATGCTGCTTCAGGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-464s1c1
Sequence:CCGGAGACCAATCCAGCTGATTCAACTCGAGTTGAATCAGCTGGATTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008705.3-607s1c1
Sequence:CCGGGACTACAAGTCTTGTGCCCATCTCGAGATGGGCACAAGACTTGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-559s1c1
Sequence:CCGGAGTGCTGAGAAAGAGATCCATCTCGAGATGGATCTCTTTCTCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-530s1c1
Sequence:CCGGACATCATTCATGGCAGTGATTCTCGAGAATCACTGCCATGAATGATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-559s21c1
Sequence:CCGGAGTGCTGAGAAAGAGATCCATCTCGAGATGGATCTCTTTCTCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-594s21c1
Sequence:CCGGCGAAGAACTGATCGACTACAACTCGAGTTGTAGTCGATCAGTTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008705
VALIDATED
NME2 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 nucleoside diphosphate kinase 2
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-252s21c1
Sequence:CCGGCGAGATCATCAAACGGTTCGACTCGAGTCGAACCGTTTGATGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-321s21c1
Sequence:CCGGAGAACACCTGAAGCAGCATTACTCGAGTAATGCTGCTTCAGGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-520s21c1
Sequence:CCGGGTTGGCAGGAACATCATTCATCTCGAGATGAATGATGTTCCTGCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-464s21c1
Sequence:CCGGAGACCAATCCAGCTGATTCAACTCGAGTTGAATCAGCTGGATTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-512s1c1
Sequence:CCGGGCATTCAAGTTGGCAGGAACACTCGAGTGTTCCTGCCAACTTGAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-252s1c1
Sequence:CCGGCGAGATCATCAAACGGTTCGACTCGAGTCGAACCGTTTGATGATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-580s1c1
Sequence:CCGGCTGTGGTTTAAGCCCGAAGAACTCGAGTTCTTCGGGCTTAAACCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-594s1c1
Sequence:CCGGCGAAGAACTGATCGACTACAACTCGAGTTGTAGTCGATCAGTTCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-520s1c1
Sequence:CCGGGTTGGCAGGAACATCATTCATCTCGAGATGAATGATGTTCCTGCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-321s1c1
Sequence:CCGGAGAACACCTGAAGCAGCATTACTCGAGTAATGCTGCTTCAGGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-464s1c1
Sequence:CCGGAGACCAATCCAGCTGATTCAACTCGAGTTGAATCAGCTGGATTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008705.3-607s1c1
Sequence:CCGGGACTACAAGTCTTGTGCCCATCTCGAGATGGGCACAAGACTTGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-559s1c1
Sequence:CCGGAGTGCTGAGAAAGAGATCCATCTCGAGATGGATCTCTTTCTCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008705.3-530s1c1
Sequence:CCGGACATCATTCATGGCAGTGATTCTCGAGAATCACTGCCATGAATGATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-559s21c1
Sequence:CCGGAGTGCTGAGAAAGAGATCCATCTCGAGATGGATCTCTTTCTCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008705.4-594s21c1
Sequence:CCGGCGAAGAACTGATCGACTACAACTCGAGTTGTAGTCGATCAGTTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)