EMAIL THIS PAGE TO A FRIEND

NME4

NME/NM23 nucleoside diphosphate kinase 4

97 Gene Product Result for
Synonyms: NDPK-D NM23H4 nm23-H4
UniProtKB ID: O00746, Q5U0M9
Gene ID:
Human(4833) Summary: The nucleoside diphosphate (NDP) kinases (EC 2.7.4.6) are ubiquitous enzymes that catalyze transfer of gamma-phosphates, via a phosphohistidine intermediate, between nucleoside and dioxynucleoside tri- and diphosphates. The enzymes are products of the nm23 gene family, which includes NME4 (Milon et al., 1997 [PubMed 9099850]
Mouse(56520) NME/NM23 nucleoside diphosphate kinase 4
Rat(685679) non-metastatic cells 4, protein expressed in
sheep(101109849) NME/NM23 nucleoside diphosphate kinase 4
naked mole-rat(101699234) NME/NM23 nucleoside diphosphate kinase 4
domestic guinea pig(100719085) NME/NM23 nucleoside diphosphate kinase 4
Zebrafish(394170) non-metastatic cells 4, protein expressed in
domestic cat(101095541) NME/NM23 nucleoside diphosphate kinase 4
cow(789324) non-metastatic cells 4, protein expressed in
chicken(395915) NME/NM23 nucleoside diphosphate kinase 4
dog(476911) non-metastatic cells 4, protein expressed in
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005009 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005009 Rosetta Predictions human pricing
NM_001109478 Rosetta Predictions rat pricing
NM_019731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029959 predicted 376
2 SASI_Hs01_00029960 predicted 295
3 SASI_Hs01_00029961 predicted 317
4 SASI_Hs01_00029962 predicted 353
5 SASI_Hs01_00029963 predicted 441
6 SASI_Hs01_00029964 predicted 385
7 SASI_Hs01_00029965 predicted 374
8 SASI_Hs01_00029966 predicted 519
9 SASI_Hs01_00029968 predicted 358
10 SASI_Hs02_00338765 predicted 333
11 SASI_Hs01_00029967 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248789 predicted 485
2 SASI_Rn02_00248790 predicted 423
3 SASI_Rn02_00248791 predicted 234
4 SASI_Rn02_00248792 predicted 265
5 SASI_Rn02_00248793 predicted 455
6 SASI_Rn02_00248794 predicted 350
7 SASI_Rn02_00248795 predicted 331
8 SASI_Rn02_00248796 predicted 508
9 SASI_Rn02_00248797 predicted 611
10 SASI_Rn02_00248798 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033247 predicted 291
2 SASI_Mm02_00324872 predicted 452
3 SASI_Mm01_00033248 predicted 452
4 SASI_Mm01_00033249 predicted 267
5 SASI_Mm01_00033250 predicted 422
6 SASI_Mm01_00033251 predicted 618
7 SASI_Mm01_00033252 predicted 618
8 SASI_Mm01_00033253 predicted 603
9 SASI_Mm02_00324873 predicted 355
10 SASI_Mm01_00033255 predicted 610
11 SASI_Mm01_00033254 predicted 437
12 SASI_Mm01_00033256 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005009
NME4 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 nucleoside diphosphate kinase 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005009.2-838s21c1
Sequence:CCGGGGGTCTTCACATTATCATAACCTCGAGGTTATGATAATGTGAAGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.2-515s1c1
Sequence:CCGGGAGATCCAGCTGTGGTTCCAGCTCGAGCTGGAACCACAGCTGGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005009.2-902s21c1
Sequence:CCGGCATGGGTGGTACACTAATTATCTCGAGATAATTAGTGTACCACCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005009.2-447s21c1
Sequence:CCGGGTGACTTCAGCGTCCACATCACTCGAGTGATGTGGACGCTGAAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-335s1c1
Sequence:CCGGCATGGTCTGGGAAGGGTACAACTCGAGTTGTACCCTTCCCAGACCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-339s1c1
Sequence:CCGGGTCTGGGAAGGGTACAATGTCCTCGAGGACATTGTACCCTTCCCAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-377s1c1
Sequence:CCGGCATGATTGGACACACCGACTCCTCGAGGAGTCGGTGTGTCCAATCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-430s1c1
Sequence:CCGGACTTCAGCGTCCACATCAGCACTCGAGTGCTGATGTGGACGCTGAAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-341s1c1
Sequence:CCGGCTGGGAAGGGTACAATGTCGTCTCGAGACGACATTGTACCCTTCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005009.2-357s21c1
Sequence:CCGGTGGTCTGGGAAGGGTACAATGCTCGAGCATTGTACCCTTCCCAGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005009
NME4 MISSION shRNA shRNA Plasmid DNA
NME/NM23 nucleoside diphosphate kinase 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005009.2-838s21c1
Sequence:CCGGGGGTCTTCACATTATCATAACCTCGAGGTTATGATAATGTGAAGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.2-515s1c1
Sequence:CCGGGAGATCCAGCTGTGGTTCCAGCTCGAGCTGGAACCACAGCTGGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005009.2-902s21c1
Sequence:CCGGCATGGGTGGTACACTAATTATCTCGAGATAATTAGTGTACCACCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005009.2-447s21c1
Sequence:CCGGGTGACTTCAGCGTCCACATCACTCGAGTGATGTGGACGCTGAAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-335s1c1
Sequence:CCGGCATGGTCTGGGAAGGGTACAACTCGAGTTGTACCCTTCCCAGACCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-339s1c1
Sequence:CCGGGTCTGGGAAGGGTACAATGTCCTCGAGGACATTGTACCCTTCCCAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-377s1c1
Sequence:CCGGCATGATTGGACACACCGACTCCTCGAGGAGTCGGTGTGTCCAATCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-430s1c1
Sequence:CCGGACTTCAGCGTCCACATCAGCACTCGAGTGCTGATGTGGACGCTGAAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-341s1c1
Sequence:CCGGCTGGGAAGGGTACAATGTCGTCTCGAGACGACATTGTACCCTTCCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005009.2-357s21c1
Sequence:CCGGTGGTCTGGGAAGGGTACAATGCTCGAGCATTGTACCCTTCCCAGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005009
NME4 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 nucleoside diphosphate kinase 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005009.2-838s21c1
Sequence:CCGGGGGTCTTCACATTATCATAACCTCGAGGTTATGATAATGTGAAGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.2-515s1c1
Sequence:CCGGGAGATCCAGCTGTGGTTCCAGCTCGAGCTGGAACCACAGCTGGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005009.2-902s21c1
Sequence:CCGGCATGGGTGGTACACTAATTATCTCGAGATAATTAGTGTACCACCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005009.2-447s21c1
Sequence:CCGGGTGACTTCAGCGTCCACATCACTCGAGTGATGTGGACGCTGAAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-335s1c1
Sequence:CCGGCATGGTCTGGGAAGGGTACAACTCGAGTTGTACCCTTCCCAGACCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-339s1c1
Sequence:CCGGGTCTGGGAAGGGTACAATGTCCTCGAGGACATTGTACCCTTCCCAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-377s1c1
Sequence:CCGGCATGATTGGACACACCGACTCCTCGAGGAGTCGGTGTGTCCAATCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-430s1c1
Sequence:CCGGACTTCAGCGTCCACATCAGCACTCGAGTGCTGATGTGGACGCTGAAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005009.x-341s1c1
Sequence:CCGGCTGGGAAGGGTACAATGTCGTCTCGAGACGACATTGTACCCTTCCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005009.2-357s21c1
Sequence:CCGGTGGTCTGGGAAGGGTACAATGCTCGAGCATTGTACCCTTCCCAGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019731
VALIDATED
NME4 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 nucleoside diphosphate kinase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-182s21c1
Sequence:CCGGCTGTGATACAACGCTTTGAGACTCGAGTCTCAAAGCGTTGTATCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-438s21c1
Sequence:CCGGCAGTGTTCACATCAGCAGGAACTCGAGTTCCTGCTGATGTGAACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019731.1-626s21c1
Sequence:CCGGCCTCTGTCAACAAGAAGTCAACTCGAGTTGACTTCTTGTTGACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-297s21c1
Sequence:CCGGCCCAGCTCTTATCAGCTACATCTCGAGATGTAGCTGATAAGAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-626s1c1
Sequence:CCGGCCTCTGTCAACAAGAAGTCAACTCGAGTTGACTTCTTGTTGACAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-182s1c1
Sequence:CCGGCTGTGATACAACGCTTTGAGACTCGAGTCTCAAAGCGTTGTATCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-366s1c1
Sequence:CCGGCCATATCTCAAGGGCCATGATCTCGAGATCATGGCCCTTGAGATATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-297s1c1
Sequence:CCGGCCCAGCTCTTATCAGCTACATCTCGAGATGTAGCTGATAAGAGCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-438s1c1
Sequence:CCGGCAGTGTTCACATCAGCAGGAACTCGAGTTCCTGCTGATGTGAACACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-366s21c1
Sequence:CCGGCCATATCTCAAGGGCCATGATCTCGAGATCATGGCCCTTGAGATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019731
VALIDATED
NME4 MISSION shRNA shRNA Plasmid DNA
NME/NM23 nucleoside diphosphate kinase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-182s21c1
Sequence:CCGGCTGTGATACAACGCTTTGAGACTCGAGTCTCAAAGCGTTGTATCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-438s21c1
Sequence:CCGGCAGTGTTCACATCAGCAGGAACTCGAGTTCCTGCTGATGTGAACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019731.1-626s21c1
Sequence:CCGGCCTCTGTCAACAAGAAGTCAACTCGAGTTGACTTCTTGTTGACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-297s21c1
Sequence:CCGGCCCAGCTCTTATCAGCTACATCTCGAGATGTAGCTGATAAGAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-626s1c1
Sequence:CCGGCCTCTGTCAACAAGAAGTCAACTCGAGTTGACTTCTTGTTGACAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-182s1c1
Sequence:CCGGCTGTGATACAACGCTTTGAGACTCGAGTCTCAAAGCGTTGTATCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-366s1c1
Sequence:CCGGCCATATCTCAAGGGCCATGATCTCGAGATCATGGCCCTTGAGATATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-297s1c1
Sequence:CCGGCCCAGCTCTTATCAGCTACATCTCGAGATGTAGCTGATAAGAGCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-438s1c1
Sequence:CCGGCAGTGTTCACATCAGCAGGAACTCGAGTTCCTGCTGATGTGAACACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-366s21c1
Sequence:CCGGCCATATCTCAAGGGCCATGATCTCGAGATCATGGCCCTTGAGATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019731
VALIDATED
NME4 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 nucleoside diphosphate kinase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-182s21c1
Sequence:CCGGCTGTGATACAACGCTTTGAGACTCGAGTCTCAAAGCGTTGTATCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-438s21c1
Sequence:CCGGCAGTGTTCACATCAGCAGGAACTCGAGTTCCTGCTGATGTGAACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019731.1-626s21c1
Sequence:CCGGCCTCTGTCAACAAGAAGTCAACTCGAGTTGACTTCTTGTTGACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-297s21c1
Sequence:CCGGCCCAGCTCTTATCAGCTACATCTCGAGATGTAGCTGATAAGAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-626s1c1
Sequence:CCGGCCTCTGTCAACAAGAAGTCAACTCGAGTTGACTTCTTGTTGACAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-182s1c1
Sequence:CCGGCTGTGATACAACGCTTTGAGACTCGAGTCTCAAAGCGTTGTATCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-366s1c1
Sequence:CCGGCCATATCTCAAGGGCCATGATCTCGAGATCATGGCCCTTGAGATATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-297s1c1
Sequence:CCGGCCCAGCTCTTATCAGCTACATCTCGAGATGTAGCTGATAAGAGCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019731.1-438s1c1
Sequence:CCGGCAGTGTTCACATCAGCAGGAACTCGAGTTCCTGCTGATGTGAACACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019731.1-366s21c1
Sequence:CCGGCCATATCTCAAGGGCCATGATCTCGAGATCATGGCCCTTGAGATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)