EMAIL THIS PAGE TO A FRIEND

NME5

NME/NM23 family member 5

58 Gene Product Result for
Synonyms: NM23-H5 NM23H5 RSPH23
UniProtKB ID: P56597, B2R5G7
Gene ID:
Mouse(75533) NME/NM23 family member 5
Zebrafish(436789) non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)
cow(785439) non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)
domestic cat(101085175) NME/NM23 family member 5
dog(610421) non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)
chicken(426732) non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)
domestic guinea pig(100725804) NME/NM23 family member 5
naked mole-rat(101709801) NME/NM23 family member 5
sheep(101108305) NME/NM23 family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003551 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080637 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080637 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080637 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003551 Rosetta Predictions human pricing
NM_080637 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335824 predicted 300
2 SASI_Hs01_00131368 predicted 345
3 SASI_Hs01_00131369 predicted 480
4 SASI_Hs01_00131370 predicted 467
5 SASI_Hs02_00335825 predicted 301
6 SASI_Hs01_00131371 predicted 400
7 SASI_Hs01_00131372 predicted 315
8 SASI_Hs02_00335826 predicted 341
9 SASI_Hs01_00131373 predicted 312
10 SASI_Hs01_00131374 predicted 403
11 SASI_Hs01_00131367 predicted 445
12 SASI_Hs01_00131375 predicted 412
13 SASI_Hs01_00131376 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136662 predicted 326
2 SASI_Mm01_00136663 predicted 481
3 SASI_Mm01_00136664 predicted 347
4 SASI_Mm01_00136667 predicted 389
5 SASI_Mm02_00338185 predicted 227
6 SASI_Mm01_00136668 predicted 375
7 SASI_Mm02_00338186 predicted 573
8 SASI_Mm02_00338187 predicted 541
9 SASI_Mm01_00136670 predicted 516
10 SASI_Mm02_00338188 predicted 219
11 SASI_Mm01_00136665 predicted 415
12 SASI_Mm01_00136666 predicted 341
13 SASI_Mm01_00136669 predicted 256
14 SASI_Mm01_00136671 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003551
NME5 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 family member 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003551.2-766s1c1
Sequence:CCGGGCTGTACTTCTACTGTTTGAACTCGAGTTCAAACAGTAGAAGTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003551.2-127s1c1
Sequence:CCGGGCCATTATCAAACCAGATATTCTCGAGAATATCTGGTTTGATAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003551.2-894s21c1
Sequence:CCGGTATAGGCTTAGAGTATGATTTCTCGAGAAATCATACTCTAAGCCTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003551.2-409s21c1
Sequence:CCGGGACAGTCTGAGGGCAATTTATCTCGAGATAAATTGCCCTCAGACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003551.2-128s21c1
Sequence:CCGGCCATTATCAAACCAGATATTGCTCGAGCAATATCTGGTTTGATAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003551.2-321s21c1
Sequence:CCGGCATGATATTAGCTAGACATAACTCGAGTTATGTCTAGCTAATATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003551
NME5 MISSION shRNA shRNA Plasmid DNA
NME/NM23 family member 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003551.2-766s1c1
Sequence:CCGGGCTGTACTTCTACTGTTTGAACTCGAGTTCAAACAGTAGAAGTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003551.2-127s1c1
Sequence:CCGGGCCATTATCAAACCAGATATTCTCGAGAATATCTGGTTTGATAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003551.2-894s21c1
Sequence:CCGGTATAGGCTTAGAGTATGATTTCTCGAGAAATCATACTCTAAGCCTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003551.2-409s21c1
Sequence:CCGGGACAGTCTGAGGGCAATTTATCTCGAGATAAATTGCCCTCAGACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003551.2-128s21c1
Sequence:CCGGCCATTATCAAACCAGATATTGCTCGAGCAATATCTGGTTTGATAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003551.2-321s21c1
Sequence:CCGGCATGATATTAGCTAGACATAACTCGAGTTATGTCTAGCTAATATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003551
NME5 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 family member 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003551.2-766s1c1
Sequence:CCGGGCTGTACTTCTACTGTTTGAACTCGAGTTCAAACAGTAGAAGTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003551.2-127s1c1
Sequence:CCGGGCCATTATCAAACCAGATATTCTCGAGAATATCTGGTTTGATAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003551.2-894s21c1
Sequence:CCGGTATAGGCTTAGAGTATGATTTCTCGAGAAATCATACTCTAAGCCTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003551.2-409s21c1
Sequence:CCGGGACAGTCTGAGGGCAATTTATCTCGAGATAAATTGCCCTCAGACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003551.2-128s21c1
Sequence:CCGGCCATTATCAAACCAGATATTGCTCGAGCAATATCTGGTTTGATAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003551.2-321s21c1
Sequence:CCGGCATGATATTAGCTAGACATAACTCGAGTTATGTCTAGCTAATATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080637
NME5 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 family member 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080637.3-535s21c1
Sequence:CCGGATGTTTCCAGCCGTGATTATTCTCGAGAATAATCACGGCTGGAAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-241s1c1
Sequence:CCGGGCTATGATATTAGCTAGACATCTCGAGATGTCTAGCTAATATCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-433s1c1
Sequence:CCGGGCCGTGATTATTGAACCCATTCTCGAGAATGGGTTCAATAATCACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-408s1c1
Sequence:CCGGGCGAGAGATCAGGTTCATGTTCTCGAGAACATGAACCTGATCTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-151s1c1
Sequence:CCGGCCCGAGCACTGTAGTAACTTTCTCGAGAAAGTTACTACAGTGCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-49s1c1
Sequence:CCGGGCCCTTATCAAGCCAGATGTTCTCGAGAACATCTGGCTTGATAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080637.3-217s21c1
Sequence:CCGGGGATCTGGATTCACCATTATTCTCGAGAATAATGGTGAATCCAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080637.3-313s21c1
Sequence:CCGGCCAAACTTAACAGCTTATATGCTCGAGCATATAAGCTGTTAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080637
NME5 MISSION shRNA shRNA Plasmid DNA
NME/NM23 family member 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080637.3-535s21c1
Sequence:CCGGATGTTTCCAGCCGTGATTATTCTCGAGAATAATCACGGCTGGAAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-241s1c1
Sequence:CCGGGCTATGATATTAGCTAGACATCTCGAGATGTCTAGCTAATATCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-433s1c1
Sequence:CCGGGCCGTGATTATTGAACCCATTCTCGAGAATGGGTTCAATAATCACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-408s1c1
Sequence:CCGGGCGAGAGATCAGGTTCATGTTCTCGAGAACATGAACCTGATCTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-151s1c1
Sequence:CCGGCCCGAGCACTGTAGTAACTTTCTCGAGAAAGTTACTACAGTGCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-49s1c1
Sequence:CCGGGCCCTTATCAAGCCAGATGTTCTCGAGAACATCTGGCTTGATAAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080637.3-217s21c1
Sequence:CCGGGGATCTGGATTCACCATTATTCTCGAGAATAATGGTGAATCCAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080637.3-313s21c1
Sequence:CCGGCCAAACTTAACAGCTTATATGCTCGAGCATATAAGCTGTTAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080637
NME5 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 family member 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080637.3-535s21c1
Sequence:CCGGATGTTTCCAGCCGTGATTATTCTCGAGAATAATCACGGCTGGAAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-241s1c1
Sequence:CCGGGCTATGATATTAGCTAGACATCTCGAGATGTCTAGCTAATATCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-433s1c1
Sequence:CCGGGCCGTGATTATTGAACCCATTCTCGAGAATGGGTTCAATAATCACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-408s1c1
Sequence:CCGGGCGAGAGATCAGGTTCATGTTCTCGAGAACATGAACCTGATCTCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-151s1c1
Sequence:CCGGCCCGAGCACTGTAGTAACTTTCTCGAGAAAGTTACTACAGTGCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080637.1-49s1c1
Sequence:CCGGGCCCTTATCAAGCCAGATGTTCTCGAGAACATCTGGCTTGATAAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080637.3-217s21c1
Sequence:CCGGGGATCTGGATTCACCATTATTCTCGAGAATAATGGTGAATCCAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080637.3-313s21c1
Sequence:CCGGCCAAACTTAACAGCTTATATGCTCGAGCATATAAGCTGTTAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)