EMAIL THIS PAGE TO A FRIEND

NME6

NME/NM23 nucleoside diphosphate kinase 6

100 Gene Product Result for
Synonyms: IPIA-ALPHA NDK 6 NM23-H6
UniProtKB ID: O75414, B4DGW7, B4DM99, Q53HM5, Q96E73, Q9BQ63
Gene ID:
Human(10201) Summary: Nucleoside diphosphate (NDP) kinases (EC 2.7.4.6), such as NME6, are ubiquitous enzymes that catalyze transfer of gamma-phosphates, via a phosphohistidine intermediate, between nucleoside and dioxynucleoside tri- and diphosphates (Mehus et al., 1999 [PubMed 10453732]
Mouse(54369) NME/NM23 nucleoside diphosphate kinase 6
Rat(58964) NME/NM23 nucleoside diphosphate kinase 6
sheep(101112170) NME/NM23 nucleoside diphosphate kinase 6
naked mole-rat(101696650) NME/NM23 nucleoside diphosphate kinase 6
domestic guinea pig(100725952) NME/NM23 nucleoside diphosphate kinase 6
Zebrafish(58120) non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)
domestic cat(101086883) NME/NM23 nucleoside diphosphate kinase 6
dog(476638) NME/NM23 nucleoside diphosphate kinase 6
chicken(426866) NME/NM23 nucleoside diphosphate kinase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005793 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005793 Rosetta Predictions human pricing
XM_001076342 Rosetta Predictions rat pricing
XM_343488 Rosetta Predictions rat pricing
NM_018757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340293 predicted 463
2 SASI_Hs01_00032199 predicted 621
3 SASI_Hs01_00032200 predicted 660
4 SASI_Hs01_00032201 predicted 667
5 SASI_Hs01_00032202 predicted 665
6 SASI_Hs01_00032203 predicted 312
7 SASI_Hs01_00032204 predicted 222
8 SASI_Hs01_00032206 predicted 623
9 SASI_Hs01_00032207 predicted 244
10 SASI_Hs01_00032208 predicted 586
11 SASI_Hs01_00032205 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352906 predicted 308
2 SASI_Rn02_00352907 predicted 348
3 SASI_Rn02_00352908 predicted 240
4 SASI_Rn02_00352909 predicted 611
5 SASI_Rn02_00352910 predicted 585
6 SASI_Rn02_00352911 predicted 588
7 SASI_Rn02_00352912 predicted 418
8 SASI_Rn02_00352913 predicted 386
9 SASI_Rn02_00352914 predicted 353
10 SASI_Rn02_00352915 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395844 predicted 235
2 SASI_Rn02_00395845 predicted 201
3 SASI_Rn02_00395846 predicted 229
4 SASI_Rn02_00395847 predicted 261
5 SASI_Rn02_00395848 predicted 267
6 SASI_Rn02_00395849 predicted 235
7 SASI_Rn02_00395850 predicted 243
8 SASI_Rn02_00395851 predicted 232
9 SASI_Rn02_00395852 predicted 224
10 SASI_Rn02_00395853 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179304 predicted 426
2 SASI_Mm01_00179305 predicted 710
3 SASI_Mm01_00179306 predicted 642
4 SASI_Mm01_00179307 predicted 207
5 SASI_Mm01_00179308 predicted 222
6 SASI_Mm01_00179309 predicted 389
7 SASI_Mm01_00179310 predicted 482
8 SASI_Mm02_00324056 predicted 427
9 SASI_Mm02_00324057 predicted 293
10 SASI_Mm02_00324058 predicted 220
11 SASI_Mm01_00179301 predicted 473
12 SASI_Mm01_00179302 predicted 638
13 SASI_Mm01_00179303 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018757
VALIDATED
NME6 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 nucleoside diphosphate kinase 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018757.1-397s21c1
Sequence:CCGGCCAACTTTGGAGGACACTGATCTCGAGATCAGTGTCCTCCAAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018757.1-831s21c1
Sequence:CCGGGCTGCAGTCCAGTTCTATCTACTCGAGTAGATAGAACTGGACTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018757.1-664s21c1
Sequence:CCGGAGGCCACAAACAACCTAACAACTCGAGTTGTTAGGTTGTTTGTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018757.1-456s21c1
Sequence:CCGGCAGATTCAATTCGTGGAAGTTCTCGAGAACTTCCACGAATTGAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018757.1-831s1c1
Sequence:CCGGGCTGCAGTCCAGTTCTATCTACTCGAGTAGATAGAACTGGACTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-397s1c1
Sequence:CCGGCCAACTTTGGAGGACACTGATCTCGAGATCAGTGTCCTCCAAAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-664s1c1
Sequence:CCGGAGGCCACAAACAACCTAACAACTCGAGTTGTTAGGTTGTTTGTGGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-223s1c1
Sequence:CCGGGCAGATTCTGAGCAACAAGTTCTCGAGAACTTGTTGCTCAGAATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-456s1c1
Sequence:CCGGCAGATTCAATTCGTGGAAGTTCTCGAGAACTTCCACGAATTGAATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018757
VALIDATED
NME6 MISSION shRNA shRNA Plasmid DNA
NME/NM23 nucleoside diphosphate kinase 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018757.1-397s21c1
Sequence:CCGGCCAACTTTGGAGGACACTGATCTCGAGATCAGTGTCCTCCAAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018757.1-831s21c1
Sequence:CCGGGCTGCAGTCCAGTTCTATCTACTCGAGTAGATAGAACTGGACTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018757.1-664s21c1
Sequence:CCGGAGGCCACAAACAACCTAACAACTCGAGTTGTTAGGTTGTTTGTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018757.1-456s21c1
Sequence:CCGGCAGATTCAATTCGTGGAAGTTCTCGAGAACTTCCACGAATTGAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018757.1-831s1c1
Sequence:CCGGGCTGCAGTCCAGTTCTATCTACTCGAGTAGATAGAACTGGACTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-397s1c1
Sequence:CCGGCCAACTTTGGAGGACACTGATCTCGAGATCAGTGTCCTCCAAAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-664s1c1
Sequence:CCGGAGGCCACAAACAACCTAACAACTCGAGTTGTTAGGTTGTTTGTGGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-223s1c1
Sequence:CCGGGCAGATTCTGAGCAACAAGTTCTCGAGAACTTGTTGCTCAGAATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-456s1c1
Sequence:CCGGCAGATTCAATTCGTGGAAGTTCTCGAGAACTTCCACGAATTGAATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018757
VALIDATED
NME6 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 nucleoside diphosphate kinase 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018757.1-397s21c1
Sequence:CCGGCCAACTTTGGAGGACACTGATCTCGAGATCAGTGTCCTCCAAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018757.1-831s21c1
Sequence:CCGGGCTGCAGTCCAGTTCTATCTACTCGAGTAGATAGAACTGGACTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018757.1-664s21c1
Sequence:CCGGAGGCCACAAACAACCTAACAACTCGAGTTGTTAGGTTGTTTGTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018757.1-456s21c1
Sequence:CCGGCAGATTCAATTCGTGGAAGTTCTCGAGAACTTCCACGAATTGAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018757.1-831s1c1
Sequence:CCGGGCTGCAGTCCAGTTCTATCTACTCGAGTAGATAGAACTGGACTGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-397s1c1
Sequence:CCGGCCAACTTTGGAGGACACTGATCTCGAGATCAGTGTCCTCCAAAGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-664s1c1
Sequence:CCGGAGGCCACAAACAACCTAACAACTCGAGTTGTTAGGTTGTTTGTGGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-223s1c1
Sequence:CCGGGCAGATTCTGAGCAACAAGTTCTCGAGAACTTGTTGCTCAGAATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018757.1-456s1c1
Sequence:CCGGCAGATTCAATTCGTGGAAGTTCTCGAGAACTTCCACGAATTGAATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005793
VALIDATED
NME6 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 nucleoside diphosphate kinase 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005793.3-308s21c1
Sequence:CCGGCCAATCCGAGCCTACATCCTTCTCGAGAAGGATGTAGGCTCGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005793.3-109s21c1
Sequence:CCGGCACTCTAGCCCTGATCAAGCCCTCGAGGGCTTGATCAGGGCTAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005793.3-783s1c1
Sequence:CCGGTCCAGGATCTAGCCTTCTATCCTCGAGGATAGAAGGCTAGATCCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005793.3-661s1c1
Sequence:CCGGCCAGACTTCTCCTAGACATCTCTCGAGAGATGTCTAGGAGAAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005793.3-783s21c1
Sequence:CCGGTCCAGGATCTAGCCTTCTATCCTCGAGGATAGAAGGCTAGATCCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-473s1c1
Sequence:CCGGGTTTCAGCCAGCAGAGAGATTCTCGAGAATCTCTCTGCTGGCTGAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-308s1c1
Sequence:CCGGCCAATCCGAGCCTACATCCTTCTCGAGAAGGATGTAGGCTCGGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-250s1c1
Sequence:CCGGCCGAGAGCATGAAGGGCGTTTCTCGAGAAACGCCCTTCATGCTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-212s1c1
Sequence:CCGGGAACTACTGTGGAGAAAGGAACTCGAGTTCCTTTCTCCACAGTAGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-109s1c1
Sequence:CCGGCACTCTAGCCCTGATCAAGCCCTCGAGGGCTTGATCAGGGCTAGAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005793.3-135s1c1
Sequence:CCGGCAGTCGCCCATCCACTGATTCCTCGAGGAATCAGTGGATGGGCGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005793.3-450s1c1
Sequence:CCGGCCACCCATGGTTCGGACTCTGCTCGAGCAGAGTCCGAACCATGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005793.3-74s1c1
Sequence:CCGGGCCTCAATCTTGCGAAGCCCTCTCGAGAGGGCTTCGCAAGATTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005793
VALIDATED
NME6 MISSION shRNA shRNA Plasmid DNA
NME/NM23 nucleoside diphosphate kinase 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005793.3-308s21c1
Sequence:CCGGCCAATCCGAGCCTACATCCTTCTCGAGAAGGATGTAGGCTCGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005793.3-109s21c1
Sequence:CCGGCACTCTAGCCCTGATCAAGCCCTCGAGGGCTTGATCAGGGCTAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005793.3-783s1c1
Sequence:CCGGTCCAGGATCTAGCCTTCTATCCTCGAGGATAGAAGGCTAGATCCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005793.3-661s1c1
Sequence:CCGGCCAGACTTCTCCTAGACATCTCTCGAGAGATGTCTAGGAGAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005793.3-783s21c1
Sequence:CCGGTCCAGGATCTAGCCTTCTATCCTCGAGGATAGAAGGCTAGATCCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-473s1c1
Sequence:CCGGGTTTCAGCCAGCAGAGAGATTCTCGAGAATCTCTCTGCTGGCTGAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-308s1c1
Sequence:CCGGCCAATCCGAGCCTACATCCTTCTCGAGAAGGATGTAGGCTCGGATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-250s1c1
Sequence:CCGGCCGAGAGCATGAAGGGCGTTTCTCGAGAAACGCCCTTCATGCTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-212s1c1
Sequence:CCGGGAACTACTGTGGAGAAAGGAACTCGAGTTCCTTTCTCCACAGTAGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-109s1c1
Sequence:CCGGCACTCTAGCCCTGATCAAGCCCTCGAGGGCTTGATCAGGGCTAGAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005793.3-135s1c1
Sequence:CCGGCAGTCGCCCATCCACTGATTCCTCGAGGAATCAGTGGATGGGCGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005793.3-450s1c1
Sequence:CCGGCCACCCATGGTTCGGACTCTGCTCGAGCAGAGTCCGAACCATGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005793.3-74s1c1
Sequence:CCGGGCCTCAATCTTGCGAAGCCCTCTCGAGAGGGCTTCGCAAGATTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005793
VALIDATED
NME6 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 nucleoside diphosphate kinase 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005793.3-308s21c1
Sequence:CCGGCCAATCCGAGCCTACATCCTTCTCGAGAAGGATGTAGGCTCGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005793.3-109s21c1
Sequence:CCGGCACTCTAGCCCTGATCAAGCCCTCGAGGGCTTGATCAGGGCTAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005793.3-783s1c1
Sequence:CCGGTCCAGGATCTAGCCTTCTATCCTCGAGGATAGAAGGCTAGATCCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005793.3-661s1c1
Sequence:CCGGCCAGACTTCTCCTAGACATCTCTCGAGAGATGTCTAGGAGAAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005793.3-783s21c1
Sequence:CCGGTCCAGGATCTAGCCTTCTATCCTCGAGGATAGAAGGCTAGATCCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-473s1c1
Sequence:CCGGGTTTCAGCCAGCAGAGAGATTCTCGAGAATCTCTCTGCTGGCTGAAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-308s1c1
Sequence:CCGGCCAATCCGAGCCTACATCCTTCTCGAGAAGGATGTAGGCTCGGATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-250s1c1
Sequence:CCGGCCGAGAGCATGAAGGGCGTTTCTCGAGAAACGCCCTTCATGCTCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-212s1c1
Sequence:CCGGGAACTACTGTGGAGAAAGGAACTCGAGTTCCTTTCTCCACAGTAGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005793.x-109s1c1
Sequence:CCGGCACTCTAGCCCTGATCAAGCCCTCGAGGGCTTGATCAGGGCTAGAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005793.3-135s1c1
Sequence:CCGGCAGTCGCCCATCCACTGATTCCTCGAGGAATCAGTGGATGGGCGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005793.3-450s1c1
Sequence:CCGGCCACCCATGGTTCGGACTCTGCTCGAGCAGAGTCCGAACCATGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005793.3-74s1c1
Sequence:CCGGGCCTCAATCTTGCGAAGCCCTCTCGAGAGGGCTTCGCAAGATTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)