EMAIL THIS PAGE TO A FRIEND

NMRK1

nicotinamide riboside kinase 1

90 Gene Product Result for
Synonyms: C9orf95 NRK1 bA235O14.2
UniProtKB ID: Q9NWW6, Q5W124, Q8N430
Gene ID:
Human(54981) Summary: Nicotinamide adenine dinucleotide (NAD+) is essential for life in all organisms, both as a coenzyme for oxidoreductases and as a source of ADP-ribosyl groups used in various reactions. Nicotinic acid and nicotinamide, collectively known as niacin, are the vitamin precursors of NAD+. Nicotinamide riboside kinases, such as NRK1, function to synthesize NAD+ through nicotinamide mononucleotide using nicotinamide riboside as the precursor (Bieganowski and Brenner, 2004 [PubMed 15137942]
Mouse(225994) nicotinamide riboside kinase 1
Rat(499330) nicotinamide riboside kinase 1
domestic guinea pig(100736032) nicotinamide riboside kinase 1
naked mole-rat(101709931) nicotinamide riboside kinase 1
sheep(101122328) nicotinamide riboside kinase 1
Zebrafish(541321) nicotinamide riboside kinase 1
dog(484162) nicotinamide riboside kinase 1
cow(510456) nicotinamide riboside kinase 1
domestic cat(101093720) nicotinamide riboside kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017881 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017881 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017881 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127603 Rosetta Predictions human pricing
NM_017881 Rosetta Predictions human pricing
NR_023352 Rosetta Predictions human pricing
NM_001024292 Rosetta Predictions rat pricing
NM_145497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329834 predicted 291
2 SASI_Hs02_00329835 predicted 335
3 SASI_Hs02_00329836 predicted 777
4 SASI_Hs02_00329837 predicted 812
5 SASI_Hs02_00329838 predicted 320
6 SASI_Hs02_00329839 predicted 801
7 SASI_Hs02_00329840 predicted 830
8 SASI_Hs02_00329841 predicted 327
9 SASI_Hs02_00329842 predicted 334
10 SASI_Hs02_00329843 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350820 predicted 292
2 SASI_Hs02_00350821 predicted 334
3 SASI_Hs01_00022701 predicted 854
4 SASI_Hs01_00022703 predicted 885
5 SASI_Hs01_00022704 predicted 322
6 SASI_Hs01_00022705 predicted 880
7 SASI_Hs01_00022706 predicted 896
8 SASI_Hs02_00350822 predicted 318
9 SASI_Hs01_00022710 predicted 338
10 SASI_Hs02_00350823 predicted 314
11 SASI_Hs01_00022702 predicted 802
12 SASI_Hs01_00022707 predicted 413
13 SASI_Hs01_00022708 predicted 538
14 SASI_Hs01_00022709 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381772 predicted 822
2 SASI_Hs02_00381773 predicted 1108
3 SASI_Hs02_00381774 predicted 1096
4 SASI_Hs02_00381775 predicted 1144
5 SASI_Hs02_00381776 predicted 703
6 SASI_Hs02_00381777 predicted 967
7 SASI_Hs02_00381778 predicted 578
8 SASI_Hs02_00381779 predicted 1136
9 SASI_Hs02_00381780 predicted 1157
10 SASI_Hs02_00381781 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086545 predicted 208
2 SASI_Rn01_00086546 predicted 371
3 SASI_Rn01_00086547 predicted 249
4 SASI_Rn01_00086548 predicted 406
5 SASI_Rn01_00086549 predicted 627
6 SASI_Rn02_00202481 predicted 549
7 SASI_Rn01_00086550 predicted 415
8 SASI_Rn01_00086551 predicted 501
9 SASI_Rn01_00086554 predicted 289
10 SASI_Rn02_00202482 predicted 493
11 SASI_Rn01_00086552 predicted 490
12 SASI_Rn01_00086553 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116760 predicted 561
2 SASI_Mm01_00116761 predicted 388
3 SASI_Mm01_00116762 predicted 429
4 SASI_Mm01_00116763 predicted 759
5 SASI_Mm01_00116764 predicted 673
6 SASI_Mm01_00116766 predicted 704
7 SASI_Mm02_00340941 predicted 683
8 SASI_Mm01_00116769 predicted 976
9 SASI_Mm02_00340942 predicted 724
10 SASI_Mm02_00340943 predicted 562
11 SASI_Mm01_00116765 predicted 943
12 SASI_Mm01_00116767 predicted 877
13 SASI_Mm01_00116768 predicted 745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017881
VALIDATED
NMRK1 MISSION shRNA Bacterial Glycerol Stock
nicotinamide riboside kinase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017881.1-440s1c1
Sequence:CCGGCAAGACACTCTGTGGTATCAACTCGAGTTGATACCACAGAGTGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_017881.1-953s1c1
Sequence:CCGGCCCAACATGTGGAACAATAAACTCGAGTTTATTGTTCCACATGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017881.1-382s1c1
Sequence:CCGGCTTGAAGCACTTAACATGGAACTCGAGTTCCATGTTAAGTGCTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017881.1-830s1c1
Sequence:CCGGCTTCCTGAAGTGAATTAGGAACTCGAGTTCCTAATTCACTTCAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017881.1-873s1c1
Sequence:CCGGCCTTCACCAAGATACAATGTACTCGAGTACATTGTATCTTGGTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017881.2-782s21c1
Sequence:CCGGGCAAGTATATGAAGATCTAATCTCGAGATTAGATCTTCATATACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017881.2-576s21c1
Sequence:CCGGATATGGAATAGAAGCTATTTCCTCGAGGAAATAGCTTCTATTCCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017881.2-655s21c1
Sequence:CCGGCAGACTCTCCGGGATACTTTGCTCGAGCAAAGTATCCCGGAGAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017881.2-882s21c1
Sequence:CCGGGGAAACTCCAAGGAGTAATTTCTCGAGAAATTACTCCTTGGAGTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017881
VALIDATED
NMRK1 MISSION shRNA shRNA Plasmid DNA
nicotinamide riboside kinase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017881.1-440s1c1
Sequence:CCGGCAAGACACTCTGTGGTATCAACTCGAGTTGATACCACAGAGTGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_017881.1-953s1c1
Sequence:CCGGCCCAACATGTGGAACAATAAACTCGAGTTTATTGTTCCACATGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017881.1-382s1c1
Sequence:CCGGCTTGAAGCACTTAACATGGAACTCGAGTTCCATGTTAAGTGCTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017881.1-830s1c1
Sequence:CCGGCTTCCTGAAGTGAATTAGGAACTCGAGTTCCTAATTCACTTCAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017881.1-873s1c1
Sequence:CCGGCCTTCACCAAGATACAATGTACTCGAGTACATTGTATCTTGGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017881.2-782s21c1
Sequence:CCGGGCAAGTATATGAAGATCTAATCTCGAGATTAGATCTTCATATACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017881.2-576s21c1
Sequence:CCGGATATGGAATAGAAGCTATTTCCTCGAGGAAATAGCTTCTATTCCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017881.2-655s21c1
Sequence:CCGGCAGACTCTCCGGGATACTTTGCTCGAGCAAAGTATCCCGGAGAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017881.2-882s21c1
Sequence:CCGGGGAAACTCCAAGGAGTAATTTCTCGAGAAATTACTCCTTGGAGTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017881
VALIDATED
NMRK1 MISSION shRNA Lentiviral Transduction Particles
nicotinamide riboside kinase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017881.1-440s1c1
Sequence:CCGGCAAGACACTCTGTGGTATCAACTCGAGTTGATACCACAGAGTGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_017881.1-953s1c1
Sequence:CCGGCCCAACATGTGGAACAATAAACTCGAGTTTATTGTTCCACATGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017881.1-382s1c1
Sequence:CCGGCTTGAAGCACTTAACATGGAACTCGAGTTCCATGTTAAGTGCTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017881.1-830s1c1
Sequence:CCGGCTTCCTGAAGTGAATTAGGAACTCGAGTTCCTAATTCACTTCAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017881.1-873s1c1
Sequence:CCGGCCTTCACCAAGATACAATGTACTCGAGTACATTGTATCTTGGTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017881.2-782s21c1
Sequence:CCGGGCAAGTATATGAAGATCTAATCTCGAGATTAGATCTTCATATACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017881.2-576s21c1
Sequence:CCGGATATGGAATAGAAGCTATTTCCTCGAGGAAATAGCTTCTATTCCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017881.2-655s21c1
Sequence:CCGGCAGACTCTCCGGGATACTTTGCTCGAGCAAAGTATCCCGGAGAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017881.2-882s21c1
Sequence:CCGGGGAAACTCCAAGGAGTAATTTCTCGAGAAATTACTCCTTGGAGTTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145497
NMRK1 MISSION shRNA Bacterial Glycerol Stock
nicotinamide riboside kinase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.1-482s1c1
Sequence:CCGGGAGAAGGAGTACCAGAGTATACTCGAGTATACTCTGGTACTCCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191139    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145497.1-1271s1c1
Sequence:CCGGCCCAAAGTAATGTCTCACATTCTCGAGAATGTGAGACATTACTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.1-225s1c1
Sequence:CCGGGAGTCTGAGATAGACATAGATCTCGAGATCTATGTCTATCTCAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-223s21c1
Sequence:CCGGCAGAGTCTGAGATAGACATAGCTCGAGCTATGTCTATCTCAGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-415s21c1
Sequence:CCGGATAAGCCTCTGGACACCATATCTCGAGATATGGTGTCCAGAGGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.2-267s1c1
Sequence:CCGGGATGTGCTTGAAGCGCTAAATCTCGAGATTTAGCGCTTCAAGCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.2-581s1c1
Sequence:CCGGCATCACCTGGGACATTGTTTACTCGAGTAAACAATGTCCCAGGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-181s21c1
Sequence:CCGGTTCCCAACTGCAGCGTCATATCTCGAGATATGACGCTGCAGTTGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-267s21c1
Sequence:CCGGGATGTGCTTGAAGCGCTAAATCTCGAGATTTAGCGCTTCAAGCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145497.2-1339s21c1
Sequence:CCGGTTTGTGCTTGTAGCCATAAATCTCGAGATTTATGGCTACAAGCACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145497
NMRK1 MISSION shRNA shRNA Plasmid DNA
nicotinamide riboside kinase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.1-482s1c1
Sequence:CCGGGAGAAGGAGTACCAGAGTATACTCGAGTATACTCTGGTACTCCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191139    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145497.1-1271s1c1
Sequence:CCGGCCCAAAGTAATGTCTCACATTCTCGAGAATGTGAGACATTACTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.1-225s1c1
Sequence:CCGGGAGTCTGAGATAGACATAGATCTCGAGATCTATGTCTATCTCAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-223s21c1
Sequence:CCGGCAGAGTCTGAGATAGACATAGCTCGAGCTATGTCTATCTCAGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-415s21c1
Sequence:CCGGATAAGCCTCTGGACACCATATCTCGAGATATGGTGTCCAGAGGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.2-267s1c1
Sequence:CCGGGATGTGCTTGAAGCGCTAAATCTCGAGATTTAGCGCTTCAAGCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.2-581s1c1
Sequence:CCGGCATCACCTGGGACATTGTTTACTCGAGTAAACAATGTCCCAGGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-181s21c1
Sequence:CCGGTTCCCAACTGCAGCGTCATATCTCGAGATATGACGCTGCAGTTGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-267s21c1
Sequence:CCGGGATGTGCTTGAAGCGCTAAATCTCGAGATTTAGCGCTTCAAGCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145497.2-1339s21c1
Sequence:CCGGTTTGTGCTTGTAGCCATAAATCTCGAGATTTATGGCTACAAGCACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145497
NMRK1 MISSION shRNA Lentiviral Transduction Particles
nicotinamide riboside kinase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.1-482s1c1
Sequence:CCGGGAGAAGGAGTACCAGAGTATACTCGAGTATACTCTGGTACTCCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191139    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145497.1-1271s1c1
Sequence:CCGGCCCAAAGTAATGTCTCACATTCTCGAGAATGTGAGACATTACTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.1-225s1c1
Sequence:CCGGGAGTCTGAGATAGACATAGATCTCGAGATCTATGTCTATCTCAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-223s21c1
Sequence:CCGGCAGAGTCTGAGATAGACATAGCTCGAGCTATGTCTATCTCAGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-415s21c1
Sequence:CCGGATAAGCCTCTGGACACCATATCTCGAGATATGGTGTCCAGAGGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.2-267s1c1
Sequence:CCGGGATGTGCTTGAAGCGCTAAATCTCGAGATTTAGCGCTTCAAGCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145497.2-581s1c1
Sequence:CCGGCATCACCTGGGACATTGTTTACTCGAGTAAACAATGTCCCAGGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-181s21c1
Sequence:CCGGTTCCCAACTGCAGCGTCATATCTCGAGATATGACGCTGCAGTTGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145497.2-267s21c1
Sequence:CCGGGATGTGCTTGAAGCGCTAAATCTCGAGATTTAGCGCTTCAAGCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145497.2-1339s21c1
Sequence:CCGGTTTGTGCTTGTAGCCATAAATCTCGAGATTTATGGCTACAAGCACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)