EMAIL THIS PAGE TO A FRIEND

NMRK2

nicotinamide riboside kinase 2

55 Gene Product Result for
Synonyms: ITGB1BP3 MIBP NRK2
UniProtKB ID: Q9NPI5, Q52M81, Q9NZK3
Gene ID:
Mouse(69564) nicotinamide riboside kinase 2
Rat(100912521) nicotinamide riboside kinase 2
Zebrafish(447879) nicotinamide riboside kinase 2
sheep(101114607) nicotinamide riboside kinase 2
naked mole-rat(101706969) nicotinamide riboside kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027120 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027120 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027120 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_170678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170678 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_125745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014446 Rosetta Predictions human pricing
NM_170678 Rosetta Predictions human pricing
NM_027120 Rosetta Predictions mouse pricing
XM_125745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059696 predicted 463
2 SASI_Hs01_00059697 predicted 283
3 SASI_Hs01_00059698 predicted 422
4 SASI_Hs01_00059699 predicted 519
5 SASI_Hs01_00059700 predicted 473
6 SASI_Hs01_00059701 predicted 413
7 SASI_Hs01_00059702 predicted 453
8 SASI_Hs01_00059703 predicted 430
9 SASI_Hs01_00059704 predicted 237
10 SASI_Hs01_00059705 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045149 predicted 735
2 SASI_Hs01_00045150 predicted 809
3 SASI_Hs01_00045151 predicted 582
4 SASI_Hs01_00045152 predicted 369
5 SASI_Hs01_00045153 predicted 364
6 SASI_Hs01_00045154 predicted 862
7 SASI_Hs02_00367601 predicted 828
8 SASI_Hs01_00045155 predicted 377
9 SASI_Hs01_00045156 predicted 831
10 SASI_Hs01_00045158 predicted 801
11 SASI_Hs01_00045157 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027120 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331576 predicted 955
2 SASI_Mm02_00331577 predicted 702
3 SASI_Mm02_00331578 predicted 667
4 SASI_Mm02_00331579 predicted 447
5 SASI_Mm02_00331580 predicted 360
6 SASI_Mm02_00331581 predicted 696
7 SASI_Mm02_00331582 predicted 840
8 SASI_Mm02_00331583 predicted 833
9 SASI_Mm02_00331584 predicted 708
10 SASI_Mm02_00331585 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209885 predicted 974
2 SASI_Mm01_00209886 predicted 716
3 SASI_Mm01_00209887 predicted 617
4 SASI_Mm01_00209888 predicted 695
5 SASI_Mm01_00209889 predicted 461
6 SASI_Mm01_00209890 predicted 375
7 SASI_Mm01_00209891 predicted 721
8 SASI_Mm01_00209892 predicted 860
9 SASI_Mm01_00209893 predicted 852
10 SASI_Mm01_00209894 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027120
NMRK2 MISSION shRNA Bacterial Glycerol Stock
nicotinamide riboside kinase 2
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027120.2-449s21c1
Sequence:CCGGAGGAGAAGAAGCCGTACTTACCTCGAGGTAAGTACGGCTTCTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027120.2-603s21c1
Sequence:CCGGATCAAGTTCTGGAGGATATTCCTCGAGGAATATCCTCCAGAACTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027120.2-956s21c1
Sequence:CCGGGAAACAACATCTACCCTAATGCTCGAGCATTAGGGTAGATGTTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027120
NMRK2 MISSION shRNA shRNA Plasmid DNA
nicotinamide riboside kinase 2
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027120.2-449s21c1
Sequence:CCGGAGGAGAAGAAGCCGTACTTACCTCGAGGTAAGTACGGCTTCTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027120.2-603s21c1
Sequence:CCGGATCAAGTTCTGGAGGATATTCCTCGAGGAATATCCTCCAGAACTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027120.2-956s21c1
Sequence:CCGGGAAACAACATCTACCCTAATGCTCGAGCATTAGGGTAGATGTTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027120
NMRK2 MISSION shRNA Lentiviral Transduction Particles
nicotinamide riboside kinase 2
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000360729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027120.2-449s21c1
Sequence:CCGGAGGAGAAGAAGCCGTACTTACCTCGAGGTAAGTACGGCTTCTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027120.2-603s21c1
Sequence:CCGGATCAAGTTCTGGAGGATATTCCTCGAGGAATATCCTCCAGAACTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027120.2-956s21c1
Sequence:CCGGGAAACAACATCTACCCTAATGCTCGAGCATTAGGGTAGATGTTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170678
NMRK2 MISSION shRNA Bacterial Glycerol Stock
nicotinamide riboside kinase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-679s21c1
Sequence:CCGGGGAGAAGTACCCGCAACTACACTCGAGTGTAGTTGCGGGTACTTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-645s21c1
Sequence:CCGGTTCCTGACCGTCCCGTATGAACTCGAGTTCATACGGGACGGTCAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-739s21c1
Sequence:CCGGGGCCCATGTACCAGAAGTATACTCGAGTATACTTCTGGTACATGGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-832s21c1
Sequence:CCGGGTGAAGTCCTGGAAGACATTCCTCGAGGAATGTCTTCCAGGACTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170678.1-753s1c1
Sequence:CCGGCATGTACCAGAAGTATAGGCACTCGAGTGCCTATACTTCTGGTACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170678
NMRK2 MISSION shRNA shRNA Plasmid DNA
nicotinamide riboside kinase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-679s21c1
Sequence:CCGGGGAGAAGTACCCGCAACTACACTCGAGTGTAGTTGCGGGTACTTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-645s21c1
Sequence:CCGGTTCCTGACCGTCCCGTATGAACTCGAGTTCATACGGGACGGTCAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-739s21c1
Sequence:CCGGGGCCCATGTACCAGAAGTATACTCGAGTATACTTCTGGTACATGGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-832s21c1
Sequence:CCGGGTGAAGTCCTGGAAGACATTCCTCGAGGAATGTCTTCCAGGACTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170678.1-753s1c1
Sequence:CCGGCATGTACCAGAAGTATAGGCACTCGAGTGCCTATACTTCTGGTACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170678
NMRK2 MISSION shRNA Lentiviral Transduction Particles
nicotinamide riboside kinase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-679s21c1
Sequence:CCGGGGAGAAGTACCCGCAACTACACTCGAGTGTAGTTGCGGGTACTTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-645s21c1
Sequence:CCGGTTCCTGACCGTCCCGTATGAACTCGAGTTCATACGGGACGGTCAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-739s21c1
Sequence:CCGGGGCCCATGTACCAGAAGTATACTCGAGTATACTTCTGGTACATGGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170678.2-832s21c1
Sequence:CCGGGTGAAGTCCTGGAAGACATTCCTCGAGGAATGTCTTCCAGGACTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170678.1-753s1c1
Sequence:CCGGCATGTACCAGAAGTATAGGCACTCGAGTGCCTATACTTCTGGTACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014446
NMRK2 MISSION shRNA Bacterial Glycerol Stock
nicotinamide riboside kinase 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-376s1c1
Sequence:CCGGCTTCCTGCTCTACAGCTACAACTCGAGTTGTAGCTGTAGAGCAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-192s1c1
Sequence:CCGGCCCAAGACCAAATAGCAGTTGCTCGAGCAACTGCTATTTGGTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-482s1c1
Sequence:CCGGCGTGAAGTCCTGGAAGACATTCTCGAGAATGTCTTCCAGGACTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-494s1c1
Sequence:CCGGGAAGACATTCAGAACTCGCTGCTCGAGCAGCGAGTTCTGAATGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-485s1c1
Sequence:CCGGGAAGTCCTGGAAGACATTCAGCTCGAGCTGAATGTCTTCCAGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-169s1c1
Sequence:CCGGCCATCAGGATGACTTCTTCAACTCGAGTTGAAGAAGTCATCCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014446
NMRK2 MISSION shRNA shRNA Plasmid DNA
nicotinamide riboside kinase 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-376s1c1
Sequence:CCGGCTTCCTGCTCTACAGCTACAACTCGAGTTGTAGCTGTAGAGCAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-192s1c1
Sequence:CCGGCCCAAGACCAAATAGCAGTTGCTCGAGCAACTGCTATTTGGTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-482s1c1
Sequence:CCGGCGTGAAGTCCTGGAAGACATTCTCGAGAATGTCTTCCAGGACTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-494s1c1
Sequence:CCGGGAAGACATTCAGAACTCGCTGCTCGAGCAGCGAGTTCTGAATGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-485s1c1
Sequence:CCGGGAAGTCCTGGAAGACATTCAGCTCGAGCTGAATGTCTTCCAGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-169s1c1
Sequence:CCGGCCATCAGGATGACTTCTTCAACTCGAGTTGAAGAAGTCATCCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014446
NMRK2 MISSION shRNA Lentiviral Transduction Particles
nicotinamide riboside kinase 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-376s1c1
Sequence:CCGGCTTCCTGCTCTACAGCTACAACTCGAGTTGTAGCTGTAGAGCAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-192s1c1
Sequence:CCGGCCCAAGACCAAATAGCAGTTGCTCGAGCAACTGCTATTTGGTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-482s1c1
Sequence:CCGGCGTGAAGTCCTGGAAGACATTCTCGAGAATGTCTTCCAGGACTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-494s1c1
Sequence:CCGGGAAGACATTCAGAACTCGCTGCTCGAGCAGCGAGTTCTGAATGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-485s1c1
Sequence:CCGGGAAGTCCTGGAAGACATTCAGCTCGAGCTGAATGTCTTCCAGGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014446.1-169s1c1
Sequence:CCGGCCATCAGGATGACTTCTTCAACTCGAGTTGAAGAAGTCATCCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125745
NMRK2 MISSION shRNA Bacterial Glycerol Stock
nicotinamide riboside kinase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-462s1c1
Sequence:CCGGGAGGAGAAGAAGCCGTACTTACTCGAGTAAGTACGGCTTCTTCTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-534s1c1
Sequence:CCGGCCAGAAGTATAGACGGGAGATCTCGAGATCTCCCGTCTATACTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-126s1c1
Sequence:CCGGCCTGACCAACAGCCTCCTCAACTCGAGTTGAGGAGGCTGTTGGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-165s1c1
Sequence:CCGGCGTGATCCATCAGGATGACTTCTCGAGAAGTCATCCTGATGGATCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-615s1c1
Sequence:CCGGCCATCAAGTTCTGGAGGATATCTCGAGATATCCTCCAGAACTTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125745
NMRK2 MISSION shRNA shRNA Plasmid DNA
nicotinamide riboside kinase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-462s1c1
Sequence:CCGGGAGGAGAAGAAGCCGTACTTACTCGAGTAAGTACGGCTTCTTCTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-534s1c1
Sequence:CCGGCCAGAAGTATAGACGGGAGATCTCGAGATCTCCCGTCTATACTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-126s1c1
Sequence:CCGGCCTGACCAACAGCCTCCTCAACTCGAGTTGAGGAGGCTGTTGGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-165s1c1
Sequence:CCGGCGTGATCCATCAGGATGACTTCTCGAGAAGTCATCCTGATGGATCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-615s1c1
Sequence:CCGGCCATCAAGTTCTGGAGGATATCTCGAGATATCCTCCAGAACTTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125745
NMRK2 MISSION shRNA Lentiviral Transduction Particles
nicotinamide riboside kinase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-462s1c1
Sequence:CCGGGAGGAGAAGAAGCCGTACTTACTCGAGTAAGTACGGCTTCTTCTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-534s1c1
Sequence:CCGGCCAGAAGTATAGACGGGAGATCTCGAGATCTCCCGTCTATACTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-126s1c1
Sequence:CCGGCCTGACCAACAGCCTCCTCAACTCGAGTTGAGGAGGCTGTTGGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-165s1c1
Sequence:CCGGCGTGATCCATCAGGATGACTTCTCGAGAAGTCATCCTGATGGATCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125745.1-615s1c1
Sequence:CCGGCCATCAAGTTCTGGAGGATATCTCGAGATATCCTCCAGAACTTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)