EMAIL THIS PAGE TO A FRIEND

NMS

neuromedin S

42 Gene Product Result for
UniProtKB ID: Q5H8A3
Gene ID:
Mouse(433292) neuromedin S
Rat(497196) neuromedin S
Goat(100860852) neuromedin S
sheep(101105563) neuromedin S
Zebrafish(100272161) neuromedin S
chicken(101750419) neuromedin S
dog(474554) neuromedin S
cow(768331) neuromedin S
chicken(101666809) neuromedin S
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011717 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_488892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_488892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_488892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011717 Rosetta Predictions human pricing
NM_001012233 Rosetta Predictions rat pricing
NM_001011684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107590 predicted 243
2 SASI_Hs01_00107591 predicted 238
3 SASI_Hs01_00107592 predicted 254
4 SASI_Hs01_00107594 predicted 257
5 SASI_Hs01_00107593 predicted 258
6 SASI_Hs01_00107595 predicted 170
7 SASI_Hs01_00107596 predicted 177
8 SASI_Hs01_00107597 predicted 164
9 SASI_Hs01_00107598 predicted 189
10 SASI_Hs01_00107599 predicted 99
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044368 predicted 257
2 SASI_Rn01_00044369 predicted 240
3 SASI_Rn01_00044370 predicted 247
4 SASI_Rn01_00044371 predicted 200
5 SASI_Rn01_00044372 predicted 258
6 SASI_Rn01_00044373 predicted 274
7 SASI_Rn01_00044374 predicted 265
8 SASI_Rn01_00044375 predicted 254
9 SASI_Rn01_00044376 predicted 244
10 SASI_Rn01_00044377 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041474 predicted 494
2 SASI_Mm01_00041475 predicted 489
3 SASI_Mm01_00041476 predicted 649
4 SASI_Mm01_00041477 predicted 465
5 SASI_Mm01_00041478 predicted 773
6 SASI_Mm01_00041479 predicted 458
7 SASI_Mm01_00041480 predicted 463
8 SASI_Mm01_00041481 predicted 489
9 SASI_Mm01_00041482 predicted 288
10 SASI_Mm01_00041483 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011717
NMS MISSION shRNA Bacterial Glycerol Stock
neuromedin S
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-49s1c1
Sequence:CCGGCTACTGCTTCTGCATGCTACACTCGAGTGTAGCATGCAGAAGCAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-118s1c1
Sequence:CCGGCTTGGATATTGTGCAGCTTGACTCGAGTCAAGCTGCACAATATCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-78s1c1
Sequence:CCGGCCTCAGGATTTCCTCAACCTTCTCGAGAAGGTTGAGGAAATCCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-313s1c1
Sequence:CCGGCAACAGGCGGATGAAGAGAATCTCGAGATTCTCTTCATCCGCCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-95s1c1
Sequence:CCGGCCTTTAGCTGATCCTTCAGATCTCGAGATCTGAAGGATCAGCTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-117s1c1
Sequence:CCGGGCTTGGATATTGTGCAGCTTGCTCGAGCAAGCTGCACAATATCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-79s1c1
Sequence:CCGGCTCAGGATTTCCTCAACCTTTCTCGAGAAAGGTTGAGGAAATCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-107s1c1
Sequence:CCGGCCTTCAGATGGCTTGGATATTCTCGAGAATATCCAAGCCATCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-220s1c1
Sequence:CCGGGTTTCACTACTCCAGAACTCACTCGAGTGAGTTCTGGAGTAGTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-242s1c1
Sequence:CCGGGAGGCAACACATCCAGTTAAACTCGAGTTTAACTGGATGTGTTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-142s1c1
Sequence:CCGGGCTGGCATATTGTCTGAGTCACTCGAGTGACTCAGACAATATGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-89s1c1
Sequence:CCGGCCTCAACCTTTAGCTGATCCTCTCGAGAGGATCAGCTAAAGGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011717
NMS MISSION shRNA shRNA Plasmid DNA
neuromedin S
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-49s1c1
Sequence:CCGGCTACTGCTTCTGCATGCTACACTCGAGTGTAGCATGCAGAAGCAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-118s1c1
Sequence:CCGGCTTGGATATTGTGCAGCTTGACTCGAGTCAAGCTGCACAATATCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-78s1c1
Sequence:CCGGCCTCAGGATTTCCTCAACCTTCTCGAGAAGGTTGAGGAAATCCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-313s1c1
Sequence:CCGGCAACAGGCGGATGAAGAGAATCTCGAGATTCTCTTCATCCGCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-95s1c1
Sequence:CCGGCCTTTAGCTGATCCTTCAGATCTCGAGATCTGAAGGATCAGCTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-117s1c1
Sequence:CCGGGCTTGGATATTGTGCAGCTTGCTCGAGCAAGCTGCACAATATCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-79s1c1
Sequence:CCGGCTCAGGATTTCCTCAACCTTTCTCGAGAAAGGTTGAGGAAATCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-107s1c1
Sequence:CCGGCCTTCAGATGGCTTGGATATTCTCGAGAATATCCAAGCCATCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-220s1c1
Sequence:CCGGGTTTCACTACTCCAGAACTCACTCGAGTGAGTTCTGGAGTAGTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-242s1c1
Sequence:CCGGGAGGCAACACATCCAGTTAAACTCGAGTTTAACTGGATGTGTTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-142s1c1
Sequence:CCGGGCTGGCATATTGTCTGAGTCACTCGAGTGACTCAGACAATATGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-89s1c1
Sequence:CCGGCCTCAACCTTTAGCTGATCCTCTCGAGAGGATCAGCTAAAGGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011717
NMS MISSION shRNA Lentiviral Transduction Particles
neuromedin S
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-49s1c1
Sequence:CCGGCTACTGCTTCTGCATGCTACACTCGAGTGTAGCATGCAGAAGCAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-118s1c1
Sequence:CCGGCTTGGATATTGTGCAGCTTGACTCGAGTCAAGCTGCACAATATCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-78s1c1
Sequence:CCGGCCTCAGGATTTCCTCAACCTTCTCGAGAAGGTTGAGGAAATCCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-313s1c1
Sequence:CCGGCAACAGGCGGATGAAGAGAATCTCGAGATTCTCTTCATCCGCCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-95s1c1
Sequence:CCGGCCTTTAGCTGATCCTTCAGATCTCGAGATCTGAAGGATCAGCTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-117s1c1
Sequence:CCGGGCTTGGATATTGTGCAGCTTGCTCGAGCAAGCTGCACAATATCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-79s1c1
Sequence:CCGGCTCAGGATTTCCTCAACCTTTCTCGAGAAAGGTTGAGGAAATCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-107s1c1
Sequence:CCGGCCTTCAGATGGCTTGGATATTCTCGAGAATATCCAAGCCATCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-220s1c1
Sequence:CCGGGTTTCACTACTCCAGAACTCACTCGAGTGAGTTCTGGAGTAGTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-242s1c1
Sequence:CCGGGAGGCAACACATCCAGTTAAACTCGAGTTTAACTGGATGTGTTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-142s1c1
Sequence:CCGGGCTGGCATATTGTCTGAGTCACTCGAGTGACTCAGACAATATGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011717.1-89s1c1
Sequence:CCGGCCTCAACCTTTAGCTGATCCTCTCGAGAGGATCAGCTAAAGGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_488892
NMS MISSION shRNA Bacterial Glycerol Stock
neuromedin S
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-339s1c1
Sequence:CCGGGCAGAGGGAAATACATTCTAACTCGAGTTAGAATGTATTTCCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_488892.1-673s1c1
Sequence:CCGGGCCAAGAGTTACTTCATGTTTCTCGAGAAACATGAAGTAACTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-37s1c1
Sequence:CCGGGCCATGCAAGTTTGCTACTATCTCGAGATAGTAGCAAACTTGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-204s1c1
Sequence:CCGGCCACTATTCTCCAATCCTGTTCTCGAGAACAGGATTGGAGAATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-318s1c1
Sequence:CCGGGCGACTGGCATACTTTCTGAACTCGAGTTCAGAAAGTATGCCAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_488892
NMS MISSION shRNA shRNA Plasmid DNA
neuromedin S
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-339s1c1
Sequence:CCGGGCAGAGGGAAATACATTCTAACTCGAGTTAGAATGTATTTCCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_488892.1-673s1c1
Sequence:CCGGGCCAAGAGTTACTTCATGTTTCTCGAGAAACATGAAGTAACTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-37s1c1
Sequence:CCGGGCCATGCAAGTTTGCTACTATCTCGAGATAGTAGCAAACTTGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-204s1c1
Sequence:CCGGCCACTATTCTCCAATCCTGTTCTCGAGAACAGGATTGGAGAATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-318s1c1
Sequence:CCGGGCGACTGGCATACTTTCTGAACTCGAGTTCAGAAAGTATGCCAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_488892
NMS MISSION shRNA Lentiviral Transduction Particles
neuromedin S
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-339s1c1
Sequence:CCGGGCAGAGGGAAATACATTCTAACTCGAGTTAGAATGTATTTCCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_488892.1-673s1c1
Sequence:CCGGGCCAAGAGTTACTTCATGTTTCTCGAGAAACATGAAGTAACTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-37s1c1
Sequence:CCGGGCCATGCAAGTTTGCTACTATCTCGAGATAGTAGCAAACTTGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-204s1c1
Sequence:CCGGCCACTATTCTCCAATCCTGTTCTCGAGAACAGGATTGGAGAATAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_488892.1-318s1c1
Sequence:CCGGGCGACTGGCATACTTTCTGAACTCGAGTTCAGAAAGTATGCCAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)