EMAIL THIS PAGE TO A FRIEND

NMT1

N-myristoyltransferase 1

175 Gene Product Result for
Synonyms: NMT
UniProtKB ID: P30419, A8K7C1, Q9UE09
Gene ID:
Human(4836) Summary: Myristate, a rare 14-carbon saturated fatty acid, is cotranslationally attached by an amide linkage to the N-terminal glycine residue of cellular and viral proteins with diverse functions. N-myristoyltransferase (NMT; EC 2.3.1.97) catalyzes the transfer of myristate from CoA to proteins. N-myristoylation appears to be irreversible and is required for full expression of the biologic activities of several N-myristoylated proteins, including the alpha subunit of the signal-transducing guanine nucleotide-binding protein (G protein) GO (GNAO1; MIM 139311) (Duronio et al., 1992 [PubMed 1570339]
Mouse(18107) N-myristoyltransferase 1
Rat(259274) N-myristoyltransferase 1
Thale Cress(835805) glycylpeptide N-tetradecanoyltransferase 1
dog(480494) N-myristoyltransferase 1
chicken(419966) N-myristoyltransferase 1
domestic cat(101082703) N-myristoyltransferase 1
cow(281351) N-myristoyltransferase 1
Horse(100050277) N-myristoyltransferase 1
sheep(101117775) N-myristoyltransferase 1
Domestic Rabbit(100340182) N-myristoyltransferase 1
naked mole-rat(101706184) N-myristoyltransferase 1
domestic guinea pig(100719854) N-myristoyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021079 Rosetta Predictions human pricing
NM_148891 Rosetta Predictions rat pricing
NM_008707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209606 predicted 668
2 SASI_Hs01_00209607 predicted 985
3 SASI_Hs01_00209608 predicted 792
4 SASI_Hs01_00209610 predicted 933
5 SASI_Hs01_00209611 predicted 1264
6 SASI_Hs01_00209612 predicted 793
7 SASI_Hs01_00209613 predicted 1515
8 SASI_Hs01_00209614 predicted 893
9 SASI_Hs01_00209615 predicted 570
10 SASI_Hs02_00354569 predicted 671
11 SASI_Hs01_00209609 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268897 predicted 1900
2 SASI_Rn01_00111459 predicted 1241
3 SASI_Rn01_00111460 predicted 912
4 SASI_Rn01_00111461 predicted 1623
5 SASI_Rn01_00111462 predicted 1714
6 SASI_Rn01_00111463 predicted 1280
7 SASI_Rn01_00111464 predicted 1847
8 SASI_Rn01_00111465 predicted 1873
9 SASI_Rn01_00111466 predicted 1910
10 SASI_Rn01_00111468 predicted 1533
11 SASI_Rn01_00111467 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157424 predicted 1529
2 SASI_Mm01_00157425 predicted 1559
3 SASI_Mm01_00157426 predicted 1588
4 SASI_Mm01_00157427 predicted 1349
5 SASI_Mm01_00157428 predicted 698
6 SASI_Mm01_00157429 predicted 1137
7 SASI_Mm01_00157430 predicted 1253
8 SASI_Mm01_00157431 predicted 1572
9 SASI_Mm01_00157432 predicted 1521
10 SASI_Mm02_00314534 predicted 925
11 SASI_Mm01_00157433 predicted 1040
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021079
VALIDATED
NMT1 MISSION shRNA Bacterial Glycerol Stock
N-myristoyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021079.3-706s1c1
Sequence:CCGGCCAGCAAACATCCATATCTATCTCGAGATAGATATGGATGTTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021079.3-285s1c1
Sequence:CCGGCCAGGAAATACAGAAGGCCATCTCGAGATGGCCTTCTGTATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021079.3-676s1c1
Sequence:CCGGCGGAAATTGGTTGGGTTCATTCTCGAGAATGAACCCAACCAATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021079.3-957s1c1
Sequence:CCGGCCTGAGCAGAAATATGACCATCTCGAGATGGTCATATTTCTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021079.3-1249s1c1
Sequence:CCGGCCAACCCACAAGAGTCTCAAACTCGAGTTTGAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-957s21c1
Sequence:CCGGCCTGAGCAGAAATATGACCATCTCGAGATGGTCATATTTCTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-1249s21c1
Sequence:CCGGCCAACCCACAAGAGTCTCAAACTCGAGTTTGAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021079.3-285s21c1
Sequence:CCGGCCAGGAAATACAGAAGGCCATCTCGAGATGGCCTTCTGTATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-676s21c1
Sequence:CCGGCGGAAATTGGTTGGGTTCATTCTCGAGAATGAACCCAACCAATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-706s21c1
Sequence:CCGGCCAGCAAACATCCATATCTATCTCGAGATAGATATGGATGTTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021079
VALIDATED
NMT1 MISSION shRNA shRNA Plasmid DNA
N-myristoyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021079.3-706s1c1
Sequence:CCGGCCAGCAAACATCCATATCTATCTCGAGATAGATATGGATGTTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021079.3-285s1c1
Sequence:CCGGCCAGGAAATACAGAAGGCCATCTCGAGATGGCCTTCTGTATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021079.3-676s1c1
Sequence:CCGGCGGAAATTGGTTGGGTTCATTCTCGAGAATGAACCCAACCAATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021079.3-957s1c1
Sequence:CCGGCCTGAGCAGAAATATGACCATCTCGAGATGGTCATATTTCTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021079.3-1249s1c1
Sequence:CCGGCCAACCCACAAGAGTCTCAAACTCGAGTTTGAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-957s21c1
Sequence:CCGGCCTGAGCAGAAATATGACCATCTCGAGATGGTCATATTTCTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-1249s21c1
Sequence:CCGGCCAACCCACAAGAGTCTCAAACTCGAGTTTGAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021079.3-285s21c1
Sequence:CCGGCCAGGAAATACAGAAGGCCATCTCGAGATGGCCTTCTGTATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-676s21c1
Sequence:CCGGCGGAAATTGGTTGGGTTCATTCTCGAGAATGAACCCAACCAATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-706s21c1
Sequence:CCGGCCAGCAAACATCCATATCTATCTCGAGATAGATATGGATGTTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021079
VALIDATED
NMT1 MISSION shRNA Lentiviral Transduction Particles
N-myristoyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021079.3-706s1c1
Sequence:CCGGCCAGCAAACATCCATATCTATCTCGAGATAGATATGGATGTTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021079.3-285s1c1
Sequence:CCGGCCAGGAAATACAGAAGGCCATCTCGAGATGGCCTTCTGTATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021079.3-676s1c1
Sequence:CCGGCGGAAATTGGTTGGGTTCATTCTCGAGAATGAACCCAACCAATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021079.3-957s1c1
Sequence:CCGGCCTGAGCAGAAATATGACCATCTCGAGATGGTCATATTTCTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021079.3-1249s1c1
Sequence:CCGGCCAACCCACAAGAGTCTCAAACTCGAGTTTGAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-957s21c1
Sequence:CCGGCCTGAGCAGAAATATGACCATCTCGAGATGGTCATATTTCTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-1249s21c1
Sequence:CCGGCCAACCCACAAGAGTCTCAAACTCGAGTTTGAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021079.3-285s21c1
Sequence:CCGGCCAGGAAATACAGAAGGCCATCTCGAGATGGCCTTCTGTATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-676s21c1
Sequence:CCGGCGGAAATTGGTTGGGTTCATTCTCGAGAATGAACCCAACCAATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_021079.3-706s21c1
Sequence:CCGGCCAGCAAACATCCATATCTATCTCGAGATAGATATGGATGTTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008707
VALIDATED
NMT1 MISSION shRNA Bacterial Glycerol Stock
N-myristoyltransferase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-1640s1c1
Sequence:CCGGCCAGCGAACTTGACAATTATACTCGAGTATAATTGTCAAGTTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-59s1c1
Sequence:CCGGCCACTGATGATGGAAGGGAATCTCGAGATTCCCTTCCATCATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-1241s1c1
Sequence:CCGGCCAACCCACAAGAGTCTGAAACTCGAGTTTCAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008707.2-698s1c1
Sequence:CCGGCCAGCAAACATCCACATCTATCTCGAGATAGATGTGGATGTTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-278s1c1
Sequence:CCGGCAGGAAATACAGAAGGCCATTCTCGAGAATGGCCTTCTGTATTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008707.3-59s21c1
Sequence:CCGGCCACTGATGATGGAAGGGAATCTCGAGATTCCCTTCCATCATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008707.3-278s21c1
Sequence:CCGGCAGGAAATACAGAAGGCCATTCTCGAGAATGGCCTTCTGTATTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008707.3-1241s21c1
Sequence:CCGGCCAACCCACAAGAGTCTGAAACTCGAGTTTCAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008707.3-1640s21c1
Sequence:CCGGCCAGCGAACTTGACAATTATACTCGAGTATAATTGTCAAGTTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008707
VALIDATED
NMT1 MISSION shRNA shRNA Plasmid DNA
N-myristoyltransferase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-1640s1c1
Sequence:CCGGCCAGCGAACTTGACAATTATACTCGAGTATAATTGTCAAGTTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-59s1c1
Sequence:CCGGCCACTGATGATGGAAGGGAATCTCGAGATTCCCTTCCATCATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-1241s1c1
Sequence:CCGGCCAACCCACAAGAGTCTGAAACTCGAGTTTCAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008707.2-698s1c1
Sequence:CCGGCCAGCAAACATCCACATCTATCTCGAGATAGATGTGGATGTTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-278s1c1
Sequence:CCGGCAGGAAATACAGAAGGCCATTCTCGAGAATGGCCTTCTGTATTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008707.3-59s21c1
Sequence:CCGGCCACTGATGATGGAAGGGAATCTCGAGATTCCCTTCCATCATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008707.3-278s21c1
Sequence:CCGGCAGGAAATACAGAAGGCCATTCTCGAGAATGGCCTTCTGTATTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008707.3-1241s21c1
Sequence:CCGGCCAACCCACAAGAGTCTGAAACTCGAGTTTCAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008707.3-1640s21c1
Sequence:CCGGCCAGCGAACTTGACAATTATACTCGAGTATAATTGTCAAGTTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008707
VALIDATED
NMT1 MISSION shRNA Lentiviral Transduction Particles
N-myristoyltransferase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-1640s1c1
Sequence:CCGGCCAGCGAACTTGACAATTATACTCGAGTATAATTGTCAAGTTCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-59s1c1
Sequence:CCGGCCACTGATGATGGAAGGGAATCTCGAGATTCCCTTCCATCATCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-1241s1c1
Sequence:CCGGCCAACCCACAAGAGTCTGAAACTCGAGTTTCAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008707.2-698s1c1
Sequence:CCGGCCAGCAAACATCCACATCTATCTCGAGATAGATGTGGATGTTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008707.2-278s1c1
Sequence:CCGGCAGGAAATACAGAAGGCCATTCTCGAGAATGGCCTTCTGTATTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008707.3-59s21c1
Sequence:CCGGCCACTGATGATGGAAGGGAATCTCGAGATTCCCTTCCATCATCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008707.3-278s21c1
Sequence:CCGGCAGGAAATACAGAAGGCCATTCTCGAGAATGGCCTTCTGTATTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008707.3-1241s21c1
Sequence:CCGGCCAACCCACAAGAGTCTGAAACTCGAGTTTCAGACTCTTGTGGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008707.3-1640s21c1
Sequence:CCGGCCAGCGAACTTGACAATTATACTCGAGTATAATTGTCAAGTTCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)