EMAIL THIS PAGE TO A FRIEND

NMU

neuromedin U

55 Gene Product Result for
UniProtKB ID: P48645
Gene ID:
Mouse(56183) neuromedin U
Rat(63887) neuromedin U
Zebrafish(407657) neuromedin U
chicken(422748) neuromedin U
cow(782109) neuromedin U
dog(611347) neuromedin U
sheep(101116654) neuromedin U
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006681 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002221 MISSION® esiRNA esiRNA targeting human NMU (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006681 Rosetta Predictions human pricing
NM_022239 Rosetta Predictions rat pricing
NM_019515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120663 predicted 440
2 SASI_Hs01_00120671 predicted 450
3 SASI_Hs01_00120662 predicted 524
4 SASI_Hs01_00120664 predicted 414
5 SASI_Hs01_00120666 predicted 433
6 SASI_Hs01_00120667 predicted 552
7 SASI_Hs01_00120668 predicted 436
8 SASI_Hs01_00120669 predicted 561
9 SASI_Hs01_00120670 predicted 435
10 SASI_Hs02_00342085 predicted 504
11 SASI_Hs01_00120665 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263013 predicted 296
2 SASI_Rn01_00110254 predicted 231
3 SASI_Rn01_00110255 predicted 253
4 SASI_Rn01_00110256 predicted 450
5 SASI_Rn01_00110257 predicted 450
6 SASI_Rn01_00110258 predicted 328
7 SASI_Rn01_00110259 predicted 444
8 SASI_Rn01_00110260 predicted 403
9 SASI_Rn01_00110262 predicted 338
10 SASI_Rn01_00110263 predicted 300
11 SASI_Rn01_00110261 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181714 predicted 349
2 SASI_Mm01_00181715 predicted 415
3 SASI_Mm01_00181716 predicted 497
4 SASI_Mm01_00181717 predicted 390
5 SASI_Mm01_00181719 predicted 205
6 SASI_Mm02_00324557 predicted 441
7 SASI_Mm01_00181720 predicted 247
8 SASI_Mm01_00181721 predicted 559
9 SASI_Mm01_00181722 predicted 257
10 SASI_Mm01_00181723 predicted 551
11 SASI_Mm01_00181718 predicted 227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006681
NMU MISSION shRNA Bacterial Glycerol Stock
neuromedin U
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006681.2-440s21c1
Sequence:CCGGCAGAAGTTGGGCAAGTCAAATCTCGAGATTTGACTTGCCCAACTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-562s1c1
Sequence:CCGGGCAAGTCAAAGTCGAGGATATCTCGAGATATCCTCGACTTTGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-449s1c1
Sequence:CCGGGCAAGTCAAATGTTGTGTCGTCTCGAGACGACACAACATTTGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006681.1-652s1c1
Sequence:CCGGCACAGAGCAATGCTATGGAATCTCGAGATTCCATAGCATTGCTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-253s1c1
Sequence:CCGGCAACAGCTACAGTTGTGGAATCTCGAGATTCCACAACTGTAGCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-373s1c1
Sequence:CCGGCCAAAGCCTCAGGAACAAGATCTCGAGATCTTGTTCCTGAGGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-437s1c1
Sequence:CCGGCACAGAAGTTGGGCAAGTCAACTCGAGTTGACTTGCCCAACTTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006681.1-651s1c1
Sequence:CCGGCCACAGAGCAATGCTATGGAACTCGAGTTCCATAGCATTGCTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006681.2-211s21c1
Sequence:CCGGCTGCCGAGGTGCTCCAATATTCTCGAGAATATTGGAGCACCTCGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006681.2-527s21c1
Sequence:CCGGAGATTCAGAGTGGACGAAGAACTCGAGTTCTTCGTCCACTCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-258s1c1
Sequence:CCGGGCTACAGTTGTGGAATGAGATCTCGAGATCTCATTCCACAACTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006681
NMU MISSION shRNA shRNA Plasmid DNA
neuromedin U
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006681.2-440s21c1
Sequence:CCGGCAGAAGTTGGGCAAGTCAAATCTCGAGATTTGACTTGCCCAACTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-562s1c1
Sequence:CCGGGCAAGTCAAAGTCGAGGATATCTCGAGATATCCTCGACTTTGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-449s1c1
Sequence:CCGGGCAAGTCAAATGTTGTGTCGTCTCGAGACGACACAACATTTGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006681.1-652s1c1
Sequence:CCGGCACAGAGCAATGCTATGGAATCTCGAGATTCCATAGCATTGCTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-253s1c1
Sequence:CCGGCAACAGCTACAGTTGTGGAATCTCGAGATTCCACAACTGTAGCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-373s1c1
Sequence:CCGGCCAAAGCCTCAGGAACAAGATCTCGAGATCTTGTTCCTGAGGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-437s1c1
Sequence:CCGGCACAGAAGTTGGGCAAGTCAACTCGAGTTGACTTGCCCAACTTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006681.1-651s1c1
Sequence:CCGGCCACAGAGCAATGCTATGGAACTCGAGTTCCATAGCATTGCTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006681.2-211s21c1
Sequence:CCGGCTGCCGAGGTGCTCCAATATTCTCGAGAATATTGGAGCACCTCGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006681.2-527s21c1
Sequence:CCGGAGATTCAGAGTGGACGAAGAACTCGAGTTCTTCGTCCACTCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-258s1c1
Sequence:CCGGGCTACAGTTGTGGAATGAGATCTCGAGATCTCATTCCACAACTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006681
NMU MISSION shRNA Lentiviral Transduction Particles
neuromedin U
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006681.2-440s21c1
Sequence:CCGGCAGAAGTTGGGCAAGTCAAATCTCGAGATTTGACTTGCCCAACTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-562s1c1
Sequence:CCGGGCAAGTCAAAGTCGAGGATATCTCGAGATATCCTCGACTTTGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-449s1c1
Sequence:CCGGGCAAGTCAAATGTTGTGTCGTCTCGAGACGACACAACATTTGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006681.1-652s1c1
Sequence:CCGGCACAGAGCAATGCTATGGAATCTCGAGATTCCATAGCATTGCTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-253s1c1
Sequence:CCGGCAACAGCTACAGTTGTGGAATCTCGAGATTCCACAACTGTAGCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-373s1c1
Sequence:CCGGCCAAAGCCTCAGGAACAAGATCTCGAGATCTTGTTCCTGAGGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-437s1c1
Sequence:CCGGCACAGAAGTTGGGCAAGTCAACTCGAGTTGACTTGCCCAACTTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006681.1-651s1c1
Sequence:CCGGCCACAGAGCAATGCTATGGAACTCGAGTTCCATAGCATTGCTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006681.2-211s21c1
Sequence:CCGGCTGCCGAGGTGCTCCAATATTCTCGAGAATATTGGAGCACCTCGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006681.2-527s21c1
Sequence:CCGGAGATTCAGAGTGGACGAAGAACTCGAGTTCTTCGTCCACTCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006681.1-258s1c1
Sequence:CCGGGCTACAGTTGTGGAATGAGATCTCGAGATCTCATTCCACAACTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019515
NMU MISSION shRNA Bacterial Glycerol Stock
neuromedin U
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-603s1c1
Sequence:CCGGCGGGAAGAGGTCAACAAGTTTCTCGAGAAACTTGTTGACCTCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-238s1c1
Sequence:CCGGCCTCAAAGATTGCAGCCAGAACTCGAGTTCTGGCTGCAATCTTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-356s1c1
Sequence:CCGGGCCGTATAGTGATGGAGATTTCTCGAGAAATCTCCATCACTATACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-528s1c1
Sequence:CCGGGAAGAGATTCAAAGCAGAATACTCGAGTATTCTGCTTTGAATCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-227s1c1
Sequence:CCGGTGCCAATATCACCTCAAAGATCTCGAGATCTTTGAGGTGATATTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019515
NMU MISSION shRNA shRNA Plasmid DNA
neuromedin U
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-603s1c1
Sequence:CCGGCGGGAAGAGGTCAACAAGTTTCTCGAGAAACTTGTTGACCTCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-238s1c1
Sequence:CCGGCCTCAAAGATTGCAGCCAGAACTCGAGTTCTGGCTGCAATCTTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-356s1c1
Sequence:CCGGGCCGTATAGTGATGGAGATTTCTCGAGAAATCTCCATCACTATACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-528s1c1
Sequence:CCGGGAAGAGATTCAAAGCAGAATACTCGAGTATTCTGCTTTGAATCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-227s1c1
Sequence:CCGGTGCCAATATCACCTCAAAGATCTCGAGATCTTTGAGGTGATATTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019515
NMU MISSION shRNA Lentiviral Transduction Particles
neuromedin U
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-603s1c1
Sequence:CCGGCGGGAAGAGGTCAACAAGTTTCTCGAGAAACTTGTTGACCTCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-238s1c1
Sequence:CCGGCCTCAAAGATTGCAGCCAGAACTCGAGTTCTGGCTGCAATCTTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-356s1c1
Sequence:CCGGGCCGTATAGTGATGGAGATTTCTCGAGAAATCTCCATCACTATACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-528s1c1
Sequence:CCGGGAAGAGATTCAAAGCAGAATACTCGAGTATTCTGCTTTGAATCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019515.1-227s1c1
Sequence:CCGGTGCCAATATCACCTCAAAGATCTCGAGATCTTTGAGGTGATATTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)