EMAIL THIS PAGE TO A FRIEND

NMUR2

neuromedin U receptor 2

80 Gene Product Result for
Synonyms: FM-4 FM4 NMU-R2 NMU2R TGR-1 TGR1
UniProtKB ID: Q9GZQ4, Q7LC54, Q96AM5, Q9NRA6
Gene ID:
Human(56923) Summary: This gene encodes a protein from the G-protein coupled receptor 1 family. This protein is a receptor for neuromedin U, which is a neuropeptide that is widely distributed in the gut and central nervous system. This receptor plays an important role in the regulation of food intake and body weight. [provided by RefSeq, Jul 2008]
Mouse(216749) neuromedin U receptor 2
Rat(64042) neuromedin U receptor 2
sheep(101107960) neuromedin U receptor 2
naked mole-rat(101703178) neuromedin U receptor 2
domestic guinea pig(100715572) neuromedin U receptor 2
chicken(427636) neuromedin U receptor 2
domestic cat(101083911) neuromedin U receptor 2
cow(507439) neuromedin U receptor 2
dog(489170) neuromedin U receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU066021 MISSION® esiRNA esiRNA targeting mouse Nmur2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020167 Rosetta Predictions human pricing
NM_022275 Rosetta Predictions rat pricing
NM_153079 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177100 predicted 379
2 SASI_Hs01_00177101 predicted 1243
3 SASI_Hs01_00177102 predicted 980
4 SASI_Hs01_00177103 predicted 388
5 SASI_Hs01_00177105 predicted 984
6 SASI_Hs01_00177106 predicted 779
7 SASI_Hs01_00177107 predicted 1048
8 SASI_Hs01_00177108 predicted 955
9 SASI_Hs01_00177109 predicted 1267
10 SASI_Hs02_00353075 predicted 969
11 SASI_Hs01_00177104 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121015 predicted 720
2 SASI_Rn01_00121016 predicted 732
3 SASI_Rn01_00121017 predicted 757
4 SASI_Rn01_00121018 predicted 892
5 SASI_Rn02_00263083 predicted 1018
6 SASI_Rn01_00121021 predicted 720
7 SASI_Rn01_00121022 predicted 508
8 SASI_Rn01_00121024 predicted 499
9 SASI_Rn02_00263084 predicted 653
10 SASI_Rn02_00263085 predicted 479
11 SASI_Rn01_00121019 predicted 290
12 SASI_Rn01_00121020 predicted 647
13 SASI_Rn01_00121023 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077246 predicted 1298
2 SASI_Mm01_00077247 predicted 279
3 SASI_Mm01_00077248 predicted 920
4 SASI_Mm01_00077249 predicted 701
5 SASI_Mm01_00077250 predicted 731
6 SASI_Mm01_00077251 predicted 346
7 SASI_Mm01_00077252 predicted 835
8 SASI_Mm02_00342908 predicted 1269
9 SASI_Mm01_00077253 predicted 828
10 SASI_Mm01_00077254 predicted 629
11 SASI_Mm01_00077245 predicted 832
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020167
NMUR2 MISSION shRNA Bacterial Glycerol Stock
neuromedin U receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020167.4-1806s21c1
Sequence:CCGGGTACGTGCTGTTCTACTTTATCTCGAGATAAAGTAGAACAGCACGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020167.4-878s21c1
Sequence:CCGGCTCATGGCACTCAGACTAAAGCTCGAGCTTTAGTCTGAGTGCCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020167.4-1279s21c1
Sequence:CCGGTGTGGAGCTGACCGAAGATATCTCGAGATATCTTCGGTCAGCTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020167.3-1451s1c1
Sequence:CCGGCCATAATGTATGCCTTCTCATCTCGAGATGAGAAGGCATACATTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-470s1c1
Sequence:CCGGGCGCAACTACCCTTTCTTGTTCTCGAGAACAAGAAAGGGTAGTTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-773s1c1
Sequence:CCGGGCCCATGTGGATCTACAATTTCTCGAGAAATTGTAGATCCACATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-1233s1c1
Sequence:CCGGCGGAACATCTTCCTGACAGAACTCGAGTTCTGTCAGGAAGATGTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-1008s1c1
Sequence:CCGGGACCGACTCTTCTTCAGCTTTCTCGAGAAAGCTGAAGAAGAGTCGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020167
NMUR2 MISSION shRNA shRNA Plasmid DNA
neuromedin U receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020167.4-1806s21c1
Sequence:CCGGGTACGTGCTGTTCTACTTTATCTCGAGATAAAGTAGAACAGCACGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020167.4-878s21c1
Sequence:CCGGCTCATGGCACTCAGACTAAAGCTCGAGCTTTAGTCTGAGTGCCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020167.4-1279s21c1
Sequence:CCGGTGTGGAGCTGACCGAAGATATCTCGAGATATCTTCGGTCAGCTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020167.3-1451s1c1
Sequence:CCGGCCATAATGTATGCCTTCTCATCTCGAGATGAGAAGGCATACATTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-470s1c1
Sequence:CCGGGCGCAACTACCCTTTCTTGTTCTCGAGAACAAGAAAGGGTAGTTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-773s1c1
Sequence:CCGGGCCCATGTGGATCTACAATTTCTCGAGAAATTGTAGATCCACATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-1233s1c1
Sequence:CCGGCGGAACATCTTCCTGACAGAACTCGAGTTCTGTCAGGAAGATGTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-1008s1c1
Sequence:CCGGGACCGACTCTTCTTCAGCTTTCTCGAGAAAGCTGAAGAAGAGTCGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020167
NMUR2 MISSION shRNA Lentiviral Transduction Particles
neuromedin U receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020167.4-1806s21c1
Sequence:CCGGGTACGTGCTGTTCTACTTTATCTCGAGATAAAGTAGAACAGCACGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020167.4-878s21c1
Sequence:CCGGCTCATGGCACTCAGACTAAAGCTCGAGCTTTAGTCTGAGTGCCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020167.4-1279s21c1
Sequence:CCGGTGTGGAGCTGACCGAAGATATCTCGAGATATCTTCGGTCAGCTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020167.3-1451s1c1
Sequence:CCGGCCATAATGTATGCCTTCTCATCTCGAGATGAGAAGGCATACATTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-470s1c1
Sequence:CCGGGCGCAACTACCCTTTCTTGTTCTCGAGAACAAGAAAGGGTAGTTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-773s1c1
Sequence:CCGGGCCCATGTGGATCTACAATTTCTCGAGAAATTGTAGATCCACATGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-1233s1c1
Sequence:CCGGCGGAACATCTTCCTGACAGAACTCGAGTTCTGTCAGGAAGATGTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020167.3-1008s1c1
Sequence:CCGGGACCGACTCTTCTTCAGCTTTCTCGAGAAAGCTGAAGAAGAGTCGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153079
NMUR2 MISSION shRNA Bacterial Glycerol Stock
neuromedin U receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-701s1c1
Sequence:CCGGCCAAACCCATATGGGTGTATACTCGAGTATACACCCATATGGGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153079.2-1803s1c1
Sequence:CCGGGCTCTCTAAATCAGGGCTAAACTCGAGTTTAGCCCTGATTTAGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-832s1c1
Sequence:CCGGGCAGACAAAGTGACTGTGAATCTCGAGATTCACAGTCACTTTGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-1241s1c1
Sequence:CCGGCCATCCACAACACCCAACTTACTCGAGTAAGTTGGGTGTTGTGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-402s1c1
Sequence:CCGGGCACAATTATCCCTTCCTGTTCTCGAGAACAGGAAGGGATAATTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153079
NMUR2 MISSION shRNA shRNA Plasmid DNA
neuromedin U receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-701s1c1
Sequence:CCGGCCAAACCCATATGGGTGTATACTCGAGTATACACCCATATGGGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153079.2-1803s1c1
Sequence:CCGGGCTCTCTAAATCAGGGCTAAACTCGAGTTTAGCCCTGATTTAGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-832s1c1
Sequence:CCGGGCAGACAAAGTGACTGTGAATCTCGAGATTCACAGTCACTTTGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-1241s1c1
Sequence:CCGGCCATCCACAACACCCAACTTACTCGAGTAAGTTGGGTGTTGTGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-402s1c1
Sequence:CCGGGCACAATTATCCCTTCCTGTTCTCGAGAACAGGAAGGGATAATTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153079
NMUR2 MISSION shRNA Lentiviral Transduction Particles
neuromedin U receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-701s1c1
Sequence:CCGGCCAAACCCATATGGGTGTATACTCGAGTATACACCCATATGGGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153079.2-1803s1c1
Sequence:CCGGGCTCTCTAAATCAGGGCTAAACTCGAGTTTAGCCCTGATTTAGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-832s1c1
Sequence:CCGGGCAGACAAAGTGACTGTGAATCTCGAGATTCACAGTCACTTTGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-1241s1c1
Sequence:CCGGCCATCCACAACACCCAACTTACTCGAGTAAGTTGGGTGTTGTGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153079.2-402s1c1
Sequence:CCGGGCACAATTATCCCTTCCTGTTCTCGAGAACAGGAAGGGATAATTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)