EMAIL THIS PAGE TO A FRIEND

NNMT

nicotinamide N-methyltransferase

64 Gene Product Result for
UniProtKB ID: P40261
Gene ID:
Human(4837) Summary: N-methylation is one method by which drug and other xenobiotic compounds are metabolized by the liver. This gene encodes the protein responsible for this enzymatic activity which uses S-adenosyl methionine as the methyl donor. [provided by RefSeq, Jul 2008]
Mouse(18113) nicotinamide N-methyltransferase
Rat(300691) nicotinamide N-methyltransferase
dog(489396) nicotinamide N-methyltransferase
naked mole-rat(101716424) nicotinamide N-methyltransferase
domestic guinea pig(100735757) nicotinamide N-methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006169 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006169 Rosetta Predictions human pricing
NM_001106819 Rosetta Predictions rat pricing
XM_217138 Rosetta Predictions rat pricing
NM_010924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209920 predicted 840
2 SASI_Hs01_00209921 predicted 1151
3 SASI_Hs01_00209922 predicted 749
4 SASI_Hs01_00209923 predicted 1345
5 SASI_Hs01_00209924 predicted 1096
6 SASI_Hs01_00209925 predicted 767
7 SASI_Hs01_00209926 predicted 752
8 SASI_Hs01_00209927 predicted 832
9 SASI_Hs01_00209928 predicted 892
10 SASI_Hs01_00209929 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222718 predicted 218
2 SASI_Rn02_00222719 predicted 527
3 SASI_Rn02_00222720 predicted 574
4 SASI_Rn02_00222721 predicted 780
5 SASI_Rn02_00222722 predicted 342
6 SASI_Rn02_00222723 predicted 588
7 SASI_Rn02_00222724 predicted 421
8 SASI_Rn02_00222725 predicted 359
9 SASI_Rn02_00222726 predicted 401
10 SASI_Rn02_00222727 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134850 predicted 787
2 SASI_Rn01_00134851 predicted 707
3 SASI_Rn01_00134852 predicted 660
4 SASI_Rn01_00134853 predicted 764
5 SASI_Rn01_00134854 predicted 784
6 SASI_Rn01_00134855 predicted 772
7 SASI_Rn01_00134856 predicted 720
8 SASI_Rn01_00134857 predicted 789
9 SASI_Rn01_00134858 predicted 714
10 SASI_Rn01_00134859 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165785 predicted 517
2 SASI_Mm01_00165786 predicted 705
3 SASI_Mm01_00165787 predicted 452
4 SASI_Mm02_00319668 predicted 443
5 SASI_Mm02_00319669 predicted 340
6 SASI_Mm01_00165788 predicted 278
7 SASI_Mm01_00165790 predicted 325
8 SASI_Mm01_00165791 predicted 222
9 SASI_Mm01_00165792 predicted 412
10 SASI_Mm01_00165793 predicted 527
11 SASI_Mm01_00165784 predicted 217
12 SASI_Mm01_00165789 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010924
VALIDATED
NNMT MISSION shRNA Bacterial Glycerol Stock
nicotinamide N-methyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-517s21c1
Sequence:CCGGGTGCAATCAAGCAGGTACTAACTCGAGTTAGTACCTGCTTGATTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-263s21c1
Sequence:CCGGATTCTGCCTGGGTGCTGTAAACTCGAGTTTACAGCACCCAGGCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010924.2-690s21c1
Sequence:CCGGGGCTTCCTGGTGATGGTAGATCTCGAGATCTACCATCACCAGGAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-718s21c1
Sequence:CCGGAGAGTAGCTACTACATGATTGCTCGAGCAATCATGTAGTAGCTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-344s21c1
Sequence:CCGGTGAGTCCTTCACGGAGATCATCTCGAGATGATCTCCGTGAAGGACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-591s1c1
Sequence:CCGGCGTGCAATCAAGCAGGTACTACTCGAGTAGTACCTGCTTGATTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-525s1c1
Sequence:CCGGGTCACCTATGTGTGTGATCTTCTCGAGAAGATCACACACATAGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010924.1-354s1c1
Sequence:CCGGGTAAAGGGAGAACTCCTGATTCTCGAGAATCAGGAGTTCTCCCTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-592s1c1
Sequence:CCGGGTGCAATCAAGCAGGTACTAACTCGAGTTAGTACCTGCTTGATTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-419s1c1
Sequence:CCGGTGAGTCCTTCACGGAGATCATCTCGAGATGATCTCCGTGAAGGACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010924
VALIDATED
NNMT MISSION shRNA shRNA Plasmid DNA
nicotinamide N-methyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-517s21c1
Sequence:CCGGGTGCAATCAAGCAGGTACTAACTCGAGTTAGTACCTGCTTGATTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-263s21c1
Sequence:CCGGATTCTGCCTGGGTGCTGTAAACTCGAGTTTACAGCACCCAGGCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010924.2-690s21c1
Sequence:CCGGGGCTTCCTGGTGATGGTAGATCTCGAGATCTACCATCACCAGGAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-718s21c1
Sequence:CCGGAGAGTAGCTACTACATGATTGCTCGAGCAATCATGTAGTAGCTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-344s21c1
Sequence:CCGGTGAGTCCTTCACGGAGATCATCTCGAGATGATCTCCGTGAAGGACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-591s1c1
Sequence:CCGGCGTGCAATCAAGCAGGTACTACTCGAGTAGTACCTGCTTGATTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-525s1c1
Sequence:CCGGGTCACCTATGTGTGTGATCTTCTCGAGAAGATCACACACATAGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010924.1-354s1c1
Sequence:CCGGGTAAAGGGAGAACTCCTGATTCTCGAGAATCAGGAGTTCTCCCTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-592s1c1
Sequence:CCGGGTGCAATCAAGCAGGTACTAACTCGAGTTAGTACCTGCTTGATTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-419s1c1
Sequence:CCGGTGAGTCCTTCACGGAGATCATCTCGAGATGATCTCCGTGAAGGACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010924
VALIDATED
NNMT MISSION shRNA Lentiviral Transduction Particles
nicotinamide N-methyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-517s21c1
Sequence:CCGGGTGCAATCAAGCAGGTACTAACTCGAGTTAGTACCTGCTTGATTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-263s21c1
Sequence:CCGGATTCTGCCTGGGTGCTGTAAACTCGAGTTTACAGCACCCAGGCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010924.2-690s21c1
Sequence:CCGGGGCTTCCTGGTGATGGTAGATCTCGAGATCTACCATCACCAGGAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-718s21c1
Sequence:CCGGAGAGTAGCTACTACATGATTGCTCGAGCAATCATGTAGTAGCTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010924.2-344s21c1
Sequence:CCGGTGAGTCCTTCACGGAGATCATCTCGAGATGATCTCCGTGAAGGACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-591s1c1
Sequence:CCGGCGTGCAATCAAGCAGGTACTACTCGAGTAGTACCTGCTTGATTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-525s1c1
Sequence:CCGGGTCACCTATGTGTGTGATCTTCTCGAGAAGATCACACACATAGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010924.1-354s1c1
Sequence:CCGGGTAAAGGGAGAACTCCTGATTCTCGAGAATCAGGAGTTCTCCCTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-592s1c1
Sequence:CCGGGTGCAATCAAGCAGGTACTAACTCGAGTTAGTACCTGCTTGATTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010924.1-419s1c1
Sequence:CCGGTGAGTCCTTCACGGAGATCATCTCGAGATGATCTCCGTGAAGGACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006169
VALIDATED
NNMT MISSION shRNA Bacterial Glycerol Stock
nicotinamide N-methyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006169.2-1338s21c1
Sequence:CCGGGCTCAAGAGCAGCTACTACATCTCGAGATGTAGTAGCTGCTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-957s21c1
Sequence:CCGGCCTCTCTGCTTGTGAATCCTTCTCGAGAAGGATTCACAAGCAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-840s21c1
Sequence:CCGGTGCAGAAAGCCAGATTCTTAACTCGAGTTAAGAATCTGGCTTTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-888s21c1
Sequence:CCGGATTCTGCCTAGACGGTGTGAACTCGAGTTCACACCGTCTAGGCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-711s1c1
Sequence:CCGGGCTCAAGAGCAGCTACTACATCTCGAGATGTAGTAGCTGCTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-330s1c1
Sequence:CCGGCCTCTCTGCTTGTGAATCCTTCTCGAGAAGGATTCACAAGCAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-801s1c1
Sequence:CCGGTGGCTACACAATCGAATGGTTCTCGAGAACCATTCGATTGTGTAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-164s1c1
Sequence:CCGGACCCTCGGGATTACCTAGAAACTCGAGTTTCTAGGTAATCCCGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-448s1c1
Sequence:CCGGGTGACCTATGTGTGTGATCTTCTCGAGAAGATCACACACATAGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-1428s21c1
Sequence:CCGGTGGCTACACAATCGAATGGTTCTCGAGAACCATTCGATTGTGTAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006169
VALIDATED
NNMT MISSION shRNA shRNA Plasmid DNA
nicotinamide N-methyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006169.2-1338s21c1
Sequence:CCGGGCTCAAGAGCAGCTACTACATCTCGAGATGTAGTAGCTGCTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-957s21c1
Sequence:CCGGCCTCTCTGCTTGTGAATCCTTCTCGAGAAGGATTCACAAGCAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-840s21c1
Sequence:CCGGTGCAGAAAGCCAGATTCTTAACTCGAGTTAAGAATCTGGCTTTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-888s21c1
Sequence:CCGGATTCTGCCTAGACGGTGTGAACTCGAGTTCACACCGTCTAGGCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-711s1c1
Sequence:CCGGGCTCAAGAGCAGCTACTACATCTCGAGATGTAGTAGCTGCTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-330s1c1
Sequence:CCGGCCTCTCTGCTTGTGAATCCTTCTCGAGAAGGATTCACAAGCAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-801s1c1
Sequence:CCGGTGGCTACACAATCGAATGGTTCTCGAGAACCATTCGATTGTGTAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-164s1c1
Sequence:CCGGACCCTCGGGATTACCTAGAAACTCGAGTTTCTAGGTAATCCCGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-448s1c1
Sequence:CCGGGTGACCTATGTGTGTGATCTTCTCGAGAAGATCACACACATAGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-1428s21c1
Sequence:CCGGTGGCTACACAATCGAATGGTTCTCGAGAACCATTCGATTGTGTAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006169
VALIDATED
NNMT MISSION shRNA Lentiviral Transduction Particles
nicotinamide N-methyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006169.2-1338s21c1
Sequence:CCGGGCTCAAGAGCAGCTACTACATCTCGAGATGTAGTAGCTGCTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-957s21c1
Sequence:CCGGCCTCTCTGCTTGTGAATCCTTCTCGAGAAGGATTCACAAGCAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-840s21c1
Sequence:CCGGTGCAGAAAGCCAGATTCTTAACTCGAGTTAAGAATCTGGCTTTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-888s21c1
Sequence:CCGGATTCTGCCTAGACGGTGTGAACTCGAGTTCACACCGTCTAGGCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-711s1c1
Sequence:CCGGGCTCAAGAGCAGCTACTACATCTCGAGATGTAGTAGCTGCTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-330s1c1
Sequence:CCGGCCTCTCTGCTTGTGAATCCTTCTCGAGAAGGATTCACAAGCAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-801s1c1
Sequence:CCGGTGGCTACACAATCGAATGGTTCTCGAGAACCATTCGATTGTGTAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-164s1c1
Sequence:CCGGACCCTCGGGATTACCTAGAAACTCGAGTTTCTAGGTAATCCCGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006169.1-448s1c1
Sequence:CCGGGTGACCTATGTGTGTGATCTTCTCGAGAAGATCACACACATAGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006169.2-1428s21c1
Sequence:CCGGTGGCTACACAATCGAATGGTTCTCGAGAACCATTCGATTGTGTAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)