EMAIL THIS PAGE TO A FRIEND

NOA1

nitric oxide associated 1

57 Gene Product Result for
Synonyms: C4orf14 MTG3 hAtNOS1 hNOA1 mAtNOS1
UniProtKB ID: Q8NC60, Q8N7L6, Q9BSQ9
Gene ID:
Mouse(56412) nitric oxide associated 1
Rat(289562) nitric oxide associated 1
naked mole-rat(101718562) nitric oxide associated 1
domestic guinea pig(100729731) nitric oxide associated 1
Thale Cress(823899) NO-associated protein 1
cow(539773) nitric oxide associated 1
domestic cat(101083512) nitric oxide associated 1
dog(611447) nitric oxide associated 1
chicken(422622) nitric oxide associated 1
Zebrafish(564706) nitric oxide associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032313 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032313 Rosetta Predictions human pricing
NM_001006959 Rosetta Predictions rat pricing
NM_019836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083350 predicted 1255
2 SASI_Hs01_00083351 predicted 1384
3 SASI_Hs01_00083352 predicted 1702
4 SASI_Hs01_00083353 predicted 1685
5 SASI_Hs01_00083354 predicted 1767
6 SASI_Hs02_00359662 predicted 1686
7 SASI_Hs01_00083356 predicted 1538
8 SASI_Hs01_00083357 predicted 1716
9 SASI_Hs01_00083358 predicted 1494
10 SASI_Hs01_00083359 predicted 1655
11 SASI_Hs01_00083355 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198513 predicted 1426
2 SASI_Rn01_00068208 predicted 1234
3 SASI_Rn01_00068209 predicted 1263
4 SASI_Rn01_00068210 predicted 1543
5 SASI_Rn01_00068211 predicted 1758
6 SASI_Rn01_00068212 predicted 550
7 SASI_Rn01_00068213 predicted 1703
8 SASI_Rn02_00198514 predicted 1594
9 SASI_Rn01_00068214 predicted 1835
10 SASI_Rn01_00068215 predicted 1007
11 SASI_Rn01_00068207 predicted 1941
12 SASI_Rn01_00068216 predicted 1778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081086 predicted 1154
2 SASI_Mm02_00325142 predicted 1806
3 SASI_Mm01_00081089 predicted 1464
4 SASI_Mm02_00325143 predicted 1562
5 SASI_Mm01_00081092 predicted 1695
6 SASI_Mm01_00081093 predicted 649
7 SASI_Mm01_00081094 predicted 1361
8 SASI_Mm02_00325144 predicted 1384
9 SASI_Mm02_00325145 predicted 579
10 SASI_Mm02_00325146 predicted 1807
11 SASI_Mm01_00081085 predicted 1197
12 SASI_Mm01_00081087 predicted 1693
13 SASI_Mm01_00081088 predicted 1363
14 SASI_Mm01_00081090 predicted 1576
15 SASI_Mm01_00081091 predicted 1391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032313
VALIDATED
NOA1 MISSION shRNA Bacterial Glycerol Stock
nitric oxide associated 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1215s21c1
Sequence:CCGGGCCAGGTACTACATTAAACCTCTCGAGAGGTTTAATGTAGTACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1048s21c1
Sequence:CCGGGAAGAGTTGATCTCTGCCCTTCTCGAGAAGGGCAGAGATCAACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-2127s1c1
Sequence:CCGGCCTTATGTACAACGTGAGGAACTCGAGTTCCTCACGTTGTACATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1513s1c1
Sequence:CCGGCAAGTAGAATTGACTGCACAACTCGAGTTGTGCAGTCAATTCTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1215s1c1
Sequence:CCGGGCCAGGTACTACATTAAACCTCTCGAGAGGTTTAATGTAGTACCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1258s1c1
Sequence:CCGGCCAACTCCTTACAGAATGTTTCTCGAGAAACATTCTGTAAGGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1258s21c1
Sequence:CCGGCCAACTCCTTACAGAATGTTTCTCGAGAAACATTCTGTAAGGAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1420s21c1
Sequence:CCGGCAGAAGGATAACATTCCCTTTCTCGAGAAAGGGAATGTTATCCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1324s21c1
Sequence:CCGGGATCTTAGTGAGCAAGAACAACTCGAGTTGTTCTTGCTCACTAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1724s1c1
Sequence:CCGGGAAATCAGTCAGCTTGGTTTACTCGAGTAAACCAAGCTGACTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1441s1c1
Sequence:CCGGGAGTTTGATGCTGATTCACTTCTCGAGAAGTGAATCAGCATCAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1324s1c1
Sequence:CCGGGATCTTAGTGAGCAAGAACAACTCGAGTTGTTCTTGCTCACTAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1420s1c1
Sequence:CCGGCAGAAGGATAACATTCCCTTTCTCGAGAAAGGGAATGTTATCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1048s1c1
Sequence:CCGGGAAGAGTTGATCTCTGCCCTTCTCGAGAAGGGCAGAGATCAACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032313
VALIDATED
NOA1 MISSION shRNA shRNA Plasmid DNA
nitric oxide associated 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1215s21c1
Sequence:CCGGGCCAGGTACTACATTAAACCTCTCGAGAGGTTTAATGTAGTACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1048s21c1
Sequence:CCGGGAAGAGTTGATCTCTGCCCTTCTCGAGAAGGGCAGAGATCAACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-2127s1c1
Sequence:CCGGCCTTATGTACAACGTGAGGAACTCGAGTTCCTCACGTTGTACATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1513s1c1
Sequence:CCGGCAAGTAGAATTGACTGCACAACTCGAGTTGTGCAGTCAATTCTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1215s1c1
Sequence:CCGGGCCAGGTACTACATTAAACCTCTCGAGAGGTTTAATGTAGTACCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1258s1c1
Sequence:CCGGCCAACTCCTTACAGAATGTTTCTCGAGAAACATTCTGTAAGGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1258s21c1
Sequence:CCGGCCAACTCCTTACAGAATGTTTCTCGAGAAACATTCTGTAAGGAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1420s21c1
Sequence:CCGGCAGAAGGATAACATTCCCTTTCTCGAGAAAGGGAATGTTATCCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1324s21c1
Sequence:CCGGGATCTTAGTGAGCAAGAACAACTCGAGTTGTTCTTGCTCACTAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1724s1c1
Sequence:CCGGGAAATCAGTCAGCTTGGTTTACTCGAGTAAACCAAGCTGACTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1441s1c1
Sequence:CCGGGAGTTTGATGCTGATTCACTTCTCGAGAAGTGAATCAGCATCAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1324s1c1
Sequence:CCGGGATCTTAGTGAGCAAGAACAACTCGAGTTGTTCTTGCTCACTAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1420s1c1
Sequence:CCGGCAGAAGGATAACATTCCCTTTCTCGAGAAAGGGAATGTTATCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1048s1c1
Sequence:CCGGGAAGAGTTGATCTCTGCCCTTCTCGAGAAGGGCAGAGATCAACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032313
VALIDATED
NOA1 MISSION shRNA Lentiviral Transduction Particles
nitric oxide associated 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1215s21c1
Sequence:CCGGGCCAGGTACTACATTAAACCTCTCGAGAGGTTTAATGTAGTACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1048s21c1
Sequence:CCGGGAAGAGTTGATCTCTGCCCTTCTCGAGAAGGGCAGAGATCAACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-2127s1c1
Sequence:CCGGCCTTATGTACAACGTGAGGAACTCGAGTTCCTCACGTTGTACATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1513s1c1
Sequence:CCGGCAAGTAGAATTGACTGCACAACTCGAGTTGTGCAGTCAATTCTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1215s1c1
Sequence:CCGGGCCAGGTACTACATTAAACCTCTCGAGAGGTTTAATGTAGTACCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1258s1c1
Sequence:CCGGCCAACTCCTTACAGAATGTTTCTCGAGAAACATTCTGTAAGGAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1258s21c1
Sequence:CCGGCCAACTCCTTACAGAATGTTTCTCGAGAAACATTCTGTAAGGAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1420s21c1
Sequence:CCGGCAGAAGGATAACATTCCCTTTCTCGAGAAAGGGAATGTTATCCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032313.2-1324s21c1
Sequence:CCGGGATCTTAGTGAGCAAGAACAACTCGAGTTGTTCTTGCTCACTAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1724s1c1
Sequence:CCGGGAAATCAGTCAGCTTGGTTTACTCGAGTAAACCAAGCTGACTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032313.2-1441s1c1
Sequence:CCGGGAGTTTGATGCTGATTCACTTCTCGAGAAGTGAATCAGCATCAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1324s1c1
Sequence:CCGGGATCTTAGTGAGCAAGAACAACTCGAGTTGTTCTTGCTCACTAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1420s1c1
Sequence:CCGGCAGAAGGATAACATTCCCTTTCTCGAGAAAGGGAATGTTATCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032313.2-1048s1c1
Sequence:CCGGGAAGAGTTGATCTCTGCCCTTCTCGAGAAGGGCAGAGATCAACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019836
VALIDATED
NOA1 MISSION shRNA Bacterial Glycerol Stock
nitric oxide associated 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1892s21c1
Sequence:CCGGGGTTGCAGTAACACCTTATTCCTCGAGGAATAAGGTGTTACTGCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1559s21c1
Sequence:CCGGTTTGCCGACACATTCTATTATCTCGAGATAATAGAATGTGTCGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019836.1-1304s1c1
Sequence:CCGGCGGCTACATAGTAGGAAGAGTCTCGAGACTCTTCCTACTATGTAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019836.2-1145s21c1
Sequence:CCGGCTGGCCAGGCACCACATTAAACTCGAGTTTAATGTGGTGCCTGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019836.1-1808s1c1
Sequence:CCGGCCCTCTTGTTGCTGAAGACATCTCGAGATGTCTTCAGCAACAAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1977s21c1
Sequence:CCGGGTCTTGCCATATATCGTTAATCTCGAGATTAACGATATATGGCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1620s21c1
Sequence:CCGGTTGGGTGGGATAGCCCGAATACTCGAGTATTCGGGCTATCCCACCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019836
VALIDATED
NOA1 MISSION shRNA shRNA Plasmid DNA
nitric oxide associated 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1892s21c1
Sequence:CCGGGGTTGCAGTAACACCTTATTCCTCGAGGAATAAGGTGTTACTGCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1559s21c1
Sequence:CCGGTTTGCCGACACATTCTATTATCTCGAGATAATAGAATGTGTCGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019836.1-1304s1c1
Sequence:CCGGCGGCTACATAGTAGGAAGAGTCTCGAGACTCTTCCTACTATGTAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019836.2-1145s21c1
Sequence:CCGGCTGGCCAGGCACCACATTAAACTCGAGTTTAATGTGGTGCCTGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019836.1-1808s1c1
Sequence:CCGGCCCTCTTGTTGCTGAAGACATCTCGAGATGTCTTCAGCAACAAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1977s21c1
Sequence:CCGGGTCTTGCCATATATCGTTAATCTCGAGATTAACGATATATGGCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1620s21c1
Sequence:CCGGTTGGGTGGGATAGCCCGAATACTCGAGTATTCGGGCTATCCCACCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019836
VALIDATED
NOA1 MISSION shRNA Lentiviral Transduction Particles
nitric oxide associated 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1892s21c1
Sequence:CCGGGGTTGCAGTAACACCTTATTCCTCGAGGAATAAGGTGTTACTGCAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1559s21c1
Sequence:CCGGTTTGCCGACACATTCTATTATCTCGAGATAATAGAATGTGTCGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019836.1-1304s1c1
Sequence:CCGGCGGCTACATAGTAGGAAGAGTCTCGAGACTCTTCCTACTATGTAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019836.2-1145s21c1
Sequence:CCGGCTGGCCAGGCACCACATTAAACTCGAGTTTAATGTGGTGCCTGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019836.1-1808s1c1
Sequence:CCGGCCCTCTTGTTGCTGAAGACATCTCGAGATGTCTTCAGCAACAAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1977s21c1
Sequence:CCGGGTCTTGCCATATATCGTTAATCTCGAGATTAACGATATATGGCAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019836.2-1620s21c1
Sequence:CCGGTTGGGTGGGATAGCCCGAATACTCGAGTATTCGGGCTATCCCACCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)