EMAIL THIS PAGE TO A FRIEND

NOC3L

nucleolar complex associated 3 homolog (S. cerevisiae)

50 Gene Product Result for
Synonyms: AD24 C10orf117 FAD24
UniProtKB ID: Q8WTT2, Q9H5M6, Q9H9D8
Gene ID:
Mouse(57753) nucleolar complex associated 3 homolog (S. cerevisiae)
Rat(361753) nucleolar complex associated 3 homolog (S. cerevisiae)
naked mole-rat(101705967) nucleolar complex associated 3 homolog (S. cerevisiae)
Domestic Rabbit(100348425) nucleolar complex associated 3 homolog (S. cerevisiae)
domestic guinea pig(100727350) nucleolar complex associated 3 homolog (S. cerevisiae)
sheep(101105962) nucleolar complex associated 3 homolog (S. cerevisiae)
Zebrafish(321289) nucleolar complex associated 3 homolog (S. cerevisiae)
chicken(423799) nucleolar complex associated 3 homolog (S. cerevisiae)
dog(477778) nucleolar complex associated 3 homolog (S. cerevisiae)
Horse(100071115) nucleolar complex associated 3 homolog (S. cerevisiae)
cow(510425) nucleolar complex associated 3 homolog (S. cerevisiae)
domestic cat(101089144) nucleolar complex associated 3 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022451 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022451 Rosetta Predictions human pricing
NM_001108523 Rosetta Predictions rat pricing
NM_021315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106579 predicted 1322
2 SASI_Hs01_00106580 predicted 1691
3 SASI_Hs02_00355713 predicted 455
4 SASI_Hs01_00106581 predicted 1651
5 SASI_Hs02_00355714 predicted 1927
6 SASI_Hs01_00106582 predicted 793
7 SASI_Hs01_00106583 predicted 588
8 SASI_Hs01_00106584 predicted 2437
9 SASI_Hs01_00106585 predicted 1666
10 SASI_Hs01_00106586 predicted 667
11 SASI_Hs01_00106578 predicted 472
12 SASI_Hs01_00106587 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239489 predicted 2061
2 SASI_Rn02_00239490 predicted 1656
3 SASI_Rn02_00239491 predicted 1324
4 SASI_Rn02_00239492 predicted 1186
5 SASI_Rn02_00239493 predicted 1241
6 SASI_Rn02_00239494 predicted 2324
7 SASI_Rn02_00239495 predicted 907
8 SASI_Rn02_00239496 predicted 2042
9 SASI_Rn02_00239497 predicted 870
10 SASI_Rn02_00239498 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113375 predicted 2534
2 SASI_Mm01_00113376 predicted 1373
3 SASI_Mm01_00113377 predicted 1855
4 SASI_Mm01_00113378 predicted 976
5 SASI_Mm01_00113380 predicted 1922
6 SASI_Mm01_00113381 predicted 2165
7 SASI_Mm01_00113382 predicted 2077
8 SASI_Mm01_00113383 predicted 1591
9 SASI_Mm01_00113384 predicted 905
10 SASI_Mm02_00325867 predicted 331
11 SASI_Mm01_00113379 predicted 1100
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021315
VALIDATED
NOC3L MISSION shRNA Bacterial Glycerol Stock
nucleolar complex associated 3 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021315.2-509s21c1
Sequence:CCGGCGAAAGCATGAGAGTGTGATACTCGAGTATCACACTCTCATGCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021315.2-2007s21c1
Sequence:CCGGCCTTCATCAAACGCCTTTGTACTCGAGTACAAAGGCGTTTGATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021315.2-1279s21c1
Sequence:CCGGCGAAGCAGTAAAGAAACTCTTCTCGAGAAGAGTTTCTTTACTGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021315.1-2775s1c1
Sequence:CCGGGCAGTCCTTCAGTTGAGATTTCTCGAGAAATCTCAACTGAAGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021315.1-1242s1c1
Sequence:CCGGCGAAGCAGTAAAGAAACTCTTCTCGAGAAGAGTTTCTTTACTGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021315.1-472s1c1
Sequence:CCGGCGAAAGCATGAGAGTGTGATACTCGAGTATCACACTCTCATGCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021315.2-2816s21c1
Sequence:CCGGGCAGTCCTTCAGTTGAGATTTCTCGAGAAATCTCAACTGAAGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021315.1-1970s1c1
Sequence:CCGGCCTTCATCAAACGCCTTTGTACTCGAGTACAAAGGCGTTTGATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021315.1-1825s1c1
Sequence:CCGGCCGATGAAATTCTATACACATCTCGAGATGTGTATAGAATTTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021315
VALIDATED
NOC3L MISSION shRNA shRNA Plasmid DNA
nucleolar complex associated 3 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021315.2-509s21c1
Sequence:CCGGCGAAAGCATGAGAGTGTGATACTCGAGTATCACACTCTCATGCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021315.2-2007s21c1
Sequence:CCGGCCTTCATCAAACGCCTTTGTACTCGAGTACAAAGGCGTTTGATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021315.2-1279s21c1
Sequence:CCGGCGAAGCAGTAAAGAAACTCTTCTCGAGAAGAGTTTCTTTACTGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021315.1-2775s1c1
Sequence:CCGGGCAGTCCTTCAGTTGAGATTTCTCGAGAAATCTCAACTGAAGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021315.1-1242s1c1
Sequence:CCGGCGAAGCAGTAAAGAAACTCTTCTCGAGAAGAGTTTCTTTACTGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021315.1-472s1c1
Sequence:CCGGCGAAAGCATGAGAGTGTGATACTCGAGTATCACACTCTCATGCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021315.2-2816s21c1
Sequence:CCGGGCAGTCCTTCAGTTGAGATTTCTCGAGAAATCTCAACTGAAGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021315.1-1970s1c1
Sequence:CCGGCCTTCATCAAACGCCTTTGTACTCGAGTACAAAGGCGTTTGATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021315.1-1825s1c1
Sequence:CCGGCCGATGAAATTCTATACACATCTCGAGATGTGTATAGAATTTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021315
VALIDATED
NOC3L MISSION shRNA Lentiviral Transduction Particles
nucleolar complex associated 3 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021315.2-509s21c1
Sequence:CCGGCGAAAGCATGAGAGTGTGATACTCGAGTATCACACTCTCATGCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021315.2-2007s21c1
Sequence:CCGGCCTTCATCAAACGCCTTTGTACTCGAGTACAAAGGCGTTTGATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021315.2-1279s21c1
Sequence:CCGGCGAAGCAGTAAAGAAACTCTTCTCGAGAAGAGTTTCTTTACTGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021315.1-2775s1c1
Sequence:CCGGGCAGTCCTTCAGTTGAGATTTCTCGAGAAATCTCAACTGAAGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021315.1-1242s1c1
Sequence:CCGGCGAAGCAGTAAAGAAACTCTTCTCGAGAAGAGTTTCTTTACTGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021315.1-472s1c1
Sequence:CCGGCGAAAGCATGAGAGTGTGATACTCGAGTATCACACTCTCATGCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021315.2-2816s21c1
Sequence:CCGGGCAGTCCTTCAGTTGAGATTTCTCGAGAAATCTCAACTGAAGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021315.1-1970s1c1
Sequence:CCGGCCTTCATCAAACGCCTTTGTACTCGAGTACAAAGGCGTTTGATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021315.1-1825s1c1
Sequence:CCGGCCGATGAAATTCTATACACATCTCGAGATGTGTATAGAATTTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022451
VALIDATED
NOC3L MISSION shRNA Bacterial Glycerol Stock
nucleolar complex associated 3 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000146279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022451.9-3208s1c1
Sequence:CCGGCCAAGACTTTACCATTCTGATCTCGAGATCAGAATGGTAAAGTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022451.9-2449s1c1
Sequence:CCGGGCCTCTGGATTTCACGAAATACTCGAGTATTTCGTGAAATCCAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022451.9-254s1c1
Sequence:CCGGGCTGTGTCTAAGAAACCCATTCTCGAGAATGGGTTTCTTAGACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022451.9-1962s1c1
Sequence:CCGGCCTTCATCAAACGCCTTTGTACTCGAGTACAAAGGCGTTTGATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022451.9-3038s1c1
Sequence:CCGGCCACCTAAAGAAGTTACCTAACTCGAGTTAGGTAACTTCTTTAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022451
VALIDATED
NOC3L MISSION shRNA shRNA Plasmid DNA
nucleolar complex associated 3 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000146279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022451.9-3208s1c1
Sequence:CCGGCCAAGACTTTACCATTCTGATCTCGAGATCAGAATGGTAAAGTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022451.9-2449s1c1
Sequence:CCGGGCCTCTGGATTTCACGAAATACTCGAGTATTTCGTGAAATCCAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022451.9-254s1c1
Sequence:CCGGGCTGTGTCTAAGAAACCCATTCTCGAGAATGGGTTTCTTAGACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022451.9-1962s1c1
Sequence:CCGGCCTTCATCAAACGCCTTTGTACTCGAGTACAAAGGCGTTTGATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022451.9-3038s1c1
Sequence:CCGGCCACCTAAAGAAGTTACCTAACTCGAGTTAGGTAACTTCTTTAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022451
VALIDATED
NOC3L MISSION shRNA Lentiviral Transduction Particles
nucleolar complex associated 3 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000146279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022451.9-3208s1c1
Sequence:CCGGCCAAGACTTTACCATTCTGATCTCGAGATCAGAATGGTAAAGTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022451.9-2449s1c1
Sequence:CCGGGCCTCTGGATTTCACGAAATACTCGAGTATTTCGTGAAATCCAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022451.9-254s1c1
Sequence:CCGGGCTGTGTCTAAGAAACCCATTCTCGAGAATGGGTTTCTTAGACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022451.9-1962s1c1
Sequence:CCGGCCTTCATCAAACGCCTTTGTACTCGAGTACAAAGGCGTTTGATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022451.9-3038s1c1
Sequence:CCGGCCACCTAAAGAAGTTACCTAACTCGAGTTAGGTAACTTCTTTAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)