EMAIL THIS PAGE TO A FRIEND

NOC4L

nucleolar complex associated 4 homolog (S. cerevisiae)

50 Gene Product Result for
Synonyms: NET49 NOC4 UTP19
UniProtKB ID: Q9BVI4, Q8N2S5, Q96I14
Gene ID:
Mouse(100608) nucleolar complex associated 4 homolog (S. cerevisiae)
Rat(360828) nucleolar complex associated 4 homolog (S. cerevisiae)
Zebrafish(554096) nucleolar complex associated 4 homolog (S. cerevisiae)
cow(514530) nucleolar complex associated 4 homolog (S. cerevisiae)
Horse(100146920) nucleolar complex associated 4 homolog (S. cerevisiae)
domestic cat(101094212) nucleolar complex associated 4 homolog (S. cerevisiae)
dog(486225) nucleolar complex associated 4 homolog (S. cerevisiae)
chicken(771548) nucleolar complex associated 4 homolog (S. cerevisiae)
sheep(101112347) nucleolar complex associated 4 homolog (S. cerevisiae)
domestic guinea pig(100717779) nucleolar complex associated 4 homolog (S. cerevisiae)
naked mole-rat(101718985) nucleolar complex associated 4 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024078 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024078 Rosetta Predictions human pricing
NM_001014129 Rosetta Predictions rat pricing
NM_153570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183230 predicted 962
2 SASI_Hs01_00183231 predicted 302
3 SASI_Hs01_00183232 predicted 291
4 SASI_Hs01_00183233 predicted 968
5 SASI_Hs01_00183234 predicted 904
6 SASI_Hs01_00183235 predicted 318
7 SASI_Hs01_00183236 predicted 564
8 SASI_Hs01_00183237 predicted 323
9 SASI_Hs01_00183238 predicted 253
10 SASI_Hs01_00183239 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057288 predicted 1179
2 SASI_Rn01_00057289 predicted 646
3 SASI_Rn01_00057290 predicted 1437
4 SASI_Rn01_00057291 predicted 1387
5 SASI_Rn01_00057292 predicted 1449
6 SASI_Rn02_00201582 predicted 1016
7 SASI_Rn01_00057293 predicted 1260
8 SASI_Rn01_00057294 predicted 195
9 SASI_Rn01_00057295 predicted 1033
10 SASI_Rn01_00057296 predicted 1278
11 SASI_Rn01_00057287 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044229 predicted 1046
2 SASI_Mm02_00343374 predicted 574
3 SASI_Mm01_00044231 predicted 300
4 SASI_Mm01_00044233 predicted 1186
5 SASI_Mm02_00343375 predicted 329
6 SASI_Mm01_00044234 predicted 1014
7 SASI_Mm01_00044235 predicted 331
8 SASI_Mm01_00044236 predicted 1447
9 SASI_Mm01_00044237 predicted 1465
10 SASI_Mm01_00044238 predicted 1188
11 SASI_Mm01_00044230 predicted 1570
12 SASI_Mm01_00044232 predicted 1604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024078
VALIDATED
NOC4L MISSION shRNA Bacterial Glycerol Stock
nucleolar complex associated 4 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-986s1c1
Sequence:CCGGGATTCACAAACACAACCTGGACTCGAGTCCAGGTTGTGTTTGTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-986s21c1
Sequence:CCGGGATTCACAAACACAACCTGGACTCGAGTCCAGGTTGTGTTTGTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-974s1c1
Sequence:CCGGGCTGTTCATCTTGATTCACAACTCGAGTTGTGAATCAAGATGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-1048s1c1
Sequence:CCGGCCTCTGTCTTTCACGTCAAGTCTCGAGACTTGACGTGAAAGACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-974s21c1
Sequence:CCGGGCTGTTCATCTTGATTCACAACTCGAGTTGTGAATCAAGATGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-1202s1c1
Sequence:CCGGCCTGCCTTTCATCTGTAACCTCTCGAGAGGTTACAGATGAAAGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-1048s21c1
Sequence:CCGGCCTCTGTCTTTCACGTCAAGTCTCGAGACTTGACGTGAAAGACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-1049s1c1
Sequence:CCGGCTCTGTCTTTCACGTCAAGTACTCGAGTACTTGACGTGAAAGACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-1202s21c1
Sequence:CCGGCCTGCCTTTCATCTGTAACCTCTCGAGAGGTTACAGATGAAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024078
VALIDATED
NOC4L MISSION shRNA shRNA Plasmid DNA
nucleolar complex associated 4 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-986s1c1
Sequence:CCGGGATTCACAAACACAACCTGGACTCGAGTCCAGGTTGTGTTTGTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-986s21c1
Sequence:CCGGGATTCACAAACACAACCTGGACTCGAGTCCAGGTTGTGTTTGTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-974s1c1
Sequence:CCGGGCTGTTCATCTTGATTCACAACTCGAGTTGTGAATCAAGATGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-1048s1c1
Sequence:CCGGCCTCTGTCTTTCACGTCAAGTCTCGAGACTTGACGTGAAAGACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-974s21c1
Sequence:CCGGGCTGTTCATCTTGATTCACAACTCGAGTTGTGAATCAAGATGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-1202s1c1
Sequence:CCGGCCTGCCTTTCATCTGTAACCTCTCGAGAGGTTACAGATGAAAGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-1048s21c1
Sequence:CCGGCCTCTGTCTTTCACGTCAAGTCTCGAGACTTGACGTGAAAGACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-1049s1c1
Sequence:CCGGCTCTGTCTTTCACGTCAAGTACTCGAGTACTTGACGTGAAAGACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-1202s21c1
Sequence:CCGGCCTGCCTTTCATCTGTAACCTCTCGAGAGGTTACAGATGAAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024078
VALIDATED
NOC4L MISSION shRNA Lentiviral Transduction Particles
nucleolar complex associated 4 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-986s1c1
Sequence:CCGGGATTCACAAACACAACCTGGACTCGAGTCCAGGTTGTGTTTGTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-986s21c1
Sequence:CCGGGATTCACAAACACAACCTGGACTCGAGTCCAGGTTGTGTTTGTGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-974s1c1
Sequence:CCGGGCTGTTCATCTTGATTCACAACTCGAGTTGTGAATCAAGATGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-1048s1c1
Sequence:CCGGCCTCTGTCTTTCACGTCAAGTCTCGAGACTTGACGTGAAAGACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-974s21c1
Sequence:CCGGGCTGTTCATCTTGATTCACAACTCGAGTTGTGAATCAAGATGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-1202s1c1
Sequence:CCGGCCTGCCTTTCATCTGTAACCTCTCGAGAGGTTACAGATGAAAGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-1048s21c1
Sequence:CCGGCCTCTGTCTTTCACGTCAAGTCTCGAGACTTGACGTGAAAGACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024078.1-1049s1c1
Sequence:CCGGCTCTGTCTTTCACGTCAAGTACTCGAGTACTTGACGTGAAAGACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024078.1-1202s21c1
Sequence:CCGGCCTGCCTTTCATCTGTAACCTCTCGAGAGGTTACAGATGAAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153570
VALIDATED
NOC4L MISSION shRNA Bacterial Glycerol Stock
nucleolar complex associated 4 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153570.2-1192s1c1
Sequence:CCGGCCTACTTATGGTCCTGCCTTTCTCGAGAAAGGCAGGACCATAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-769s1c1
Sequence:CCGGCGTTCACTTGAAGGAGCACAACTCGAGTTGTGCTCCTTCAAGTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-1193s1c1
Sequence:CCGGCTACTTATGGTCCTGCCTTTACTCGAGTAAAGGCAGGACCATAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-991s1c1
Sequence:CCGGCCATAAACACAACCTGGAGTACTCGAGTACTCCAGGTTGTGTTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-1830s1c1
Sequence:CCGGCCAGATACTCTGGAAGAGCAACTCGAGTTGCTCTTCCAGAGTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153570.2-1193s21c2
Sequence:CCGGCTACTTATGGTCCTGCCTTTACTCGAGTAAAGGCAGGACCATAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153570.2-991s21c1
Sequence:CCGGCCATAAACACAACCTGGAGTACTCGAGTACTCCAGGTTGTGTTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153570.2-769s21c1
Sequence:CCGGCGTTCACTTGAAGGAGCACAACTCGAGTTGTGCTCCTTCAAGTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153570.2-1830s21c1
Sequence:CCGGCCAGATACTCTGGAAGAGCAACTCGAGTTGCTCTTCCAGAGTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153570
VALIDATED
NOC4L MISSION shRNA shRNA Plasmid DNA
nucleolar complex associated 4 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153570.2-1192s1c1
Sequence:CCGGCCTACTTATGGTCCTGCCTTTCTCGAGAAAGGCAGGACCATAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-769s1c1
Sequence:CCGGCGTTCACTTGAAGGAGCACAACTCGAGTTGTGCTCCTTCAAGTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-1193s1c1
Sequence:CCGGCTACTTATGGTCCTGCCTTTACTCGAGTAAAGGCAGGACCATAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-991s1c1
Sequence:CCGGCCATAAACACAACCTGGAGTACTCGAGTACTCCAGGTTGTGTTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-1830s1c1
Sequence:CCGGCCAGATACTCTGGAAGAGCAACTCGAGTTGCTCTTCCAGAGTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153570.2-1193s21c2
Sequence:CCGGCTACTTATGGTCCTGCCTTTACTCGAGTAAAGGCAGGACCATAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153570.2-991s21c1
Sequence:CCGGCCATAAACACAACCTGGAGTACTCGAGTACTCCAGGTTGTGTTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153570.2-769s21c1
Sequence:CCGGCGTTCACTTGAAGGAGCACAACTCGAGTTGTGCTCCTTCAAGTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153570.2-1830s21c1
Sequence:CCGGCCAGATACTCTGGAAGAGCAACTCGAGTTGCTCTTCCAGAGTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153570
VALIDATED
NOC4L MISSION shRNA Lentiviral Transduction Particles
nucleolar complex associated 4 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153570.2-1192s1c1
Sequence:CCGGCCTACTTATGGTCCTGCCTTTCTCGAGAAAGGCAGGACCATAAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-769s1c1
Sequence:CCGGCGTTCACTTGAAGGAGCACAACTCGAGTTGTGCTCCTTCAAGTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-1193s1c1
Sequence:CCGGCTACTTATGGTCCTGCCTTTACTCGAGTAAAGGCAGGACCATAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-991s1c1
Sequence:CCGGCCATAAACACAACCTGGAGTACTCGAGTACTCCAGGTTGTGTTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153570.2-1830s1c1
Sequence:CCGGCCAGATACTCTGGAAGAGCAACTCGAGTTGCTCTTCCAGAGTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153570.2-1193s21c2
Sequence:CCGGCTACTTATGGTCCTGCCTTTACTCGAGTAAAGGCAGGACCATAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153570.2-991s21c1
Sequence:CCGGCCATAAACACAACCTGGAGTACTCGAGTACTCCAGGTTGTGTTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153570.2-769s21c1
Sequence:CCGGCGTTCACTTGAAGGAGCACAACTCGAGTTGTGCTCCTTCAAGTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153570.2-1830s21c1
Sequence:CCGGCCAGATACTCTGGAAGAGCAACTCGAGTTGCTCTTCCAGAGTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)