EMAIL THIS PAGE TO A FRIEND

NOD1

nucleotide-binding oligomerization domain containing 1

49 Gene Product Result for
Synonyms: CARD4 CLR7.1 NLRC1
UniProtKB ID: Q9Y239, Q549U4, Q8IWF5
Gene ID:
Human(10392) Summary: This gene encodes a member of the NOD (nucleotide-binding oligomerization domain) family. This member is a cytosolic protein. It contains an N-terminal caspase recruitment domain (CARD), a centrally located nucleotide-binding domain (NBD), and 10 tandem leucine-rich repeats (LRRs) in its C terminus. The CARD is involved in apoptotic signaling, LRRs participate in protein-protein interactions, and mutations in the NBD may affect the process of oligomerization and subsequent function of the LRR domain. This protein is an intracellular pattern-recognition receptor (PRR) that initiates inflammation in response to a subset of bacteria through the detection of bacterial diaminopimelic acid. Multiple alternatively spliced transcript variants differring in the 5' UTR have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Oct 2009]
Mouse(107607) nucleotide-binding oligomerization domain containing 1
Rat(500133) nucleotide-binding oligomerization domain containing 1
Zebrafish(100330810) nucleotide-binding oligomerization domain containing 1
Horse(100069844) nucleotide-binding oligomerization domain containing 1
cow(781426) nucleotide-binding oligomerization domain containing 1
domestic cat(101086963) nucleotide-binding oligomerization domain containing 1
chicken(420677) nucleotide-binding oligomerization domain containing 1
dog(482382) nucleotide-binding oligomerization domain containing 1
sheep(101102721) nucleotide-binding oligomerization domain containing 1
naked mole-rat(101724724) nucleotide-binding oligomerization domain containing 1
Domestic Rabbit(100345423) nucleotide-binding oligomerization domain containing 1
domestic guinea pig(100722894) nucleotide-binding oligomerization domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006092 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041761 MISSION® esiRNA esiRNA targeting mouse Nod1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006092 Rosetta Predictions human pricing
NM_001109236 Rosetta Predictions rat pricing
NM_172729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192916 predicted 3088
2 SASI_Hs01_00192917 predicted 845
3 SASI_Hs01_00192918 predicted 3091
4 SASI_Hs01_00192919 predicted 446
5 SASI_Hs01_00192920 predicted 3203
6 SASI_Hs01_00192921 predicted 511
7 SASI_Hs01_00192922 predicted 3196
8 SASI_Hs01_00192923 predicted 3122
9 SASI_Hs01_00192924 predicted 3208
10 SASI_Hs02_00340873 predicted 3109
11 SASI_Hs01_00192915 predicted 3113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246424 predicted 2750
2 SASI_Rn02_00246425 predicted 2923
3 SASI_Rn02_00246426 predicted 2836
4 SASI_Rn02_00246427 predicted 2820
5 SASI_Rn02_00246428 predicted 417
6 SASI_Rn02_00246429 predicted 2432
7 SASI_Rn02_00246430 predicted 3013
8 SASI_Rn02_00246431 predicted 3088
9 SASI_Rn02_00246432 predicted 1773
10 SASI_Rn02_00246433 predicted 3001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111233 predicted 2959
2 SASI_Mm01_00111234 predicted 305
3 SASI_Mm01_00111235 predicted 450
4 SASI_Mm01_00111236 predicted 2874
5 SASI_Mm01_00111237 predicted 3043
6 SASI_Mm01_00111238 predicted 3029
7 SASI_Mm01_00111239 predicted 816
8 SASI_Mm01_00111240 predicted 1680
9 SASI_Mm01_00111241 predicted 1316
10 SASI_Mm01_00111242 predicted 3152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172729
NOD1 MISSION shRNA Bacterial Glycerol Stock
nucleotide-binding oligomerization domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2442s21c1
Sequence:CCGGCTTTAGCCGTCTCACGGTTATCTCGAGATAACCGTGAGACGGCTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2511s21c1
Sequence:CCGGTGAGGAACTGACCAAGTATAACTCGAGTTATACTTGGTCAGTTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-1789s21c1
Sequence:CCGGCAGGGCCAGTCTTACGAATTTCTCGAGAAATTCGTAAGACTGGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172729.1-2551s1c1
Sequence:CCGGCAAGTATAAGATCGTGACGTTCTCGAGAACGTCACGATCTTATACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172729.2-3548s21c1
Sequence:CCGGCCCAGTGACTGCATGGTTATTCTCGAGAATAACCATGCAGTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-1447s21c1
Sequence:CCGGTGGATCATCTTCCGTTGTTTCCTCGAGGAAACAACGGAAGATGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172729.2-3598s21c1
Sequence:CCGGCTCACTGTACAGGTCTGTTTCCTCGAGGAAACAGACCTGTACAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2535s21c1
Sequence:CCGGCGTGACGTTCCTGGGTTTATACTCGAGTATAAACCCAGGAACGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2946s21c1
Sequence:CCGGGAACCAGACGCTACGGCATTTCTCGAGAAATGCCGTAGCGTCTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172729.1-1465s1c1
Sequence:CCGGGCTCTTCTGTTGGATCATCTTCTCGAGAAGATGATCCAACAGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172729
NOD1 MISSION shRNA shRNA Plasmid DNA
nucleotide-binding oligomerization domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2442s21c1
Sequence:CCGGCTTTAGCCGTCTCACGGTTATCTCGAGATAACCGTGAGACGGCTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2511s21c1
Sequence:CCGGTGAGGAACTGACCAAGTATAACTCGAGTTATACTTGGTCAGTTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-1789s21c1
Sequence:CCGGCAGGGCCAGTCTTACGAATTTCTCGAGAAATTCGTAAGACTGGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172729.1-2551s1c1
Sequence:CCGGCAAGTATAAGATCGTGACGTTCTCGAGAACGTCACGATCTTATACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172729.2-3548s21c1
Sequence:CCGGCCCAGTGACTGCATGGTTATTCTCGAGAATAACCATGCAGTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-1447s21c1
Sequence:CCGGTGGATCATCTTCCGTTGTTTCCTCGAGGAAACAACGGAAGATGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172729.2-3598s21c1
Sequence:CCGGCTCACTGTACAGGTCTGTTTCCTCGAGGAAACAGACCTGTACAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2535s21c1
Sequence:CCGGCGTGACGTTCCTGGGTTTATACTCGAGTATAAACCCAGGAACGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2946s21c1
Sequence:CCGGGAACCAGACGCTACGGCATTTCTCGAGAAATGCCGTAGCGTCTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172729.1-1465s1c1
Sequence:CCGGGCTCTTCTGTTGGATCATCTTCTCGAGAAGATGATCCAACAGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172729
NOD1 MISSION shRNA Lentiviral Transduction Particles
nucleotide-binding oligomerization domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2442s21c1
Sequence:CCGGCTTTAGCCGTCTCACGGTTATCTCGAGATAACCGTGAGACGGCTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2511s21c1
Sequence:CCGGTGAGGAACTGACCAAGTATAACTCGAGTTATACTTGGTCAGTTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-1789s21c1
Sequence:CCGGCAGGGCCAGTCTTACGAATTTCTCGAGAAATTCGTAAGACTGGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172729.1-2551s1c1
Sequence:CCGGCAAGTATAAGATCGTGACGTTCTCGAGAACGTCACGATCTTATACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172729.2-3548s21c1
Sequence:CCGGCCCAGTGACTGCATGGTTATTCTCGAGAATAACCATGCAGTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-1447s21c1
Sequence:CCGGTGGATCATCTTCCGTTGTTTCCTCGAGGAAACAACGGAAGATGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172729.2-3598s21c1
Sequence:CCGGCTCACTGTACAGGTCTGTTTCCTCGAGGAAACAGACCTGTACAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2535s21c1
Sequence:CCGGCGTGACGTTCCTGGGTTTATACTCGAGTATAAACCCAGGAACGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172729.2-2946s21c1
Sequence:CCGGGAACCAGACGCTACGGCATTTCTCGAGAAATGCCGTAGCGTCTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172729.1-1465s1c1
Sequence:CCGGGCTCTTCTGTTGGATCATCTTCTCGAGAAGATGATCCAACAGAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006092
NOD1 MISSION shRNA Bacterial Glycerol Stock
nucleotide-binding oligomerization domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-670s1c1
Sequence:CCGGGTCCGAGTTCTTCCTCTACTTCTCGAGAAGTAGAGGAAGAACTCGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2672s1c1
Sequence:CCGGGAAGAGCTGACCAAATACAAACTCGAGTTTGTATTTGGTCAGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-545s1c1
Sequence:CCGGGTGGACAACTTGCTGAAGAATCTCGAGATTCTTCAGCAAGTTGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2209s1c1
Sequence:CCGGGTTGTCCAAAGCCAAACAGAACTCGAGTTCTGTTTGGCTTTGGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2545s1c1
Sequence:CCGGCCTAGACCTAGACAACAACAACTCGAGTTGTTGTTGTCTAGGTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2671s1c1
Sequence:CCGGCGAAGAGCTGACCAAATACAACTCGAGTTGTATTTGGTCAGCTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-1678s1c1
Sequence:CCGGGATGACCCTGACAGATGTCTTCTCGAGAAGACATCTGTCAGGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2782s1c1
Sequence:CCGGCACGCATCTTAAACTGGGAAACTCGAGTTTCCCAGTTTAAGATGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-3100s1c1
Sequence:CCGGGAAAGTCAACCAGACGTTAAACTCGAGTTTAACGTCTGGTTGACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-3106s1c1
Sequence:CCGGCAACCAGACGTTAAAGCATTTCTCGAGAAATGCTTTAACGTCTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006092
NOD1 MISSION shRNA shRNA Plasmid DNA
nucleotide-binding oligomerization domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-670s1c1
Sequence:CCGGGTCCGAGTTCTTCCTCTACTTCTCGAGAAGTAGAGGAAGAACTCGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2672s1c1
Sequence:CCGGGAAGAGCTGACCAAATACAAACTCGAGTTTGTATTTGGTCAGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-545s1c1
Sequence:CCGGGTGGACAACTTGCTGAAGAATCTCGAGATTCTTCAGCAAGTTGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2209s1c1
Sequence:CCGGGTTGTCCAAAGCCAAACAGAACTCGAGTTCTGTTTGGCTTTGGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2545s1c1
Sequence:CCGGCCTAGACCTAGACAACAACAACTCGAGTTGTTGTTGTCTAGGTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2671s1c1
Sequence:CCGGCGAAGAGCTGACCAAATACAACTCGAGTTGTATTTGGTCAGCTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-1678s1c1
Sequence:CCGGGATGACCCTGACAGATGTCTTCTCGAGAAGACATCTGTCAGGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2782s1c1
Sequence:CCGGCACGCATCTTAAACTGGGAAACTCGAGTTTCCCAGTTTAAGATGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-3100s1c1
Sequence:CCGGGAAAGTCAACCAGACGTTAAACTCGAGTTTAACGTCTGGTTGACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-3106s1c1
Sequence:CCGGCAACCAGACGTTAAAGCATTTCTCGAGAAATGCTTTAACGTCTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006092
NOD1 MISSION shRNA Lentiviral Transduction Particles
nucleotide-binding oligomerization domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-670s1c1
Sequence:CCGGGTCCGAGTTCTTCCTCTACTTCTCGAGAAGTAGAGGAAGAACTCGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2672s1c1
Sequence:CCGGGAAGAGCTGACCAAATACAAACTCGAGTTTGTATTTGGTCAGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-545s1c1
Sequence:CCGGGTGGACAACTTGCTGAAGAATCTCGAGATTCTTCAGCAAGTTGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2209s1c1
Sequence:CCGGGTTGTCCAAAGCCAAACAGAACTCGAGTTCTGTTTGGCTTTGGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2545s1c1
Sequence:CCGGCCTAGACCTAGACAACAACAACTCGAGTTGTTGTTGTCTAGGTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2671s1c1
Sequence:CCGGCGAAGAGCTGACCAAATACAACTCGAGTTGTATTTGGTCAGCTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-1678s1c1
Sequence:CCGGGATGACCCTGACAGATGTCTTCTCGAGAAGACATCTGTCAGGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-2782s1c1
Sequence:CCGGCACGCATCTTAAACTGGGAAACTCGAGTTTCCCAGTTTAAGATGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-3100s1c1
Sequence:CCGGGAAAGTCAACCAGACGTTAAACTCGAGTTTAACGTCTGGTTGACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006092.1-3106s1c1
Sequence:CCGGCAACCAGACGTTAAAGCATTTCTCGAGAAATGCTTTAACGTCTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)