EMAIL THIS PAGE TO A FRIEND

NOG

noggin

88 Gene Product Result for
Synonyms: SYM1 SYNS1
UniProtKB ID: Q13253
Gene ID:
Human(9241) Summary: The secreted polypeptide, encoded by this gene, binds and inactivates members of the transforming growth factor-beta (TGF-beta) superfamily signaling proteins, such as bone morphogenetic protein-4 (BMP4). By diffusing through extracellular matrices more efficiently than members of the TGF-beta superfamily, this protein may have a principal role in creating morphogenic gradients. The protein appears to have pleiotropic effect, both early in development as well as in later stages. It was originally isolated from Xenopus based on its ability to restore normal dorsal-ventral body axis in embryos that had been artificially ventralized by UV treatment. The results of the mouse knockout of the ortholog suggest that it is involved in numerous developmental processes, such as neural tube fusion and joint formation. Recently, several dominant human NOG mutations in unrelated families with proximal symphalangism (SYM1) and multiple synostoses syndrome (SYNS1) were identified; both SYM1 and SYNS1 have multiple joint fusion as their principal feature, and map to the same region (17q22) as this gene. All of these mutations altered evolutionarily conserved amino acid residues. The amino acid sequence of this human gene is highly homologous to that of Xenopus, rat and mouse. [provided by RefSeq, Jul 2008]
Mouse(18121) noggin
Rat(25495) noggin
cow(538769) noggin
sheep(780490) noggin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005450 Rosetta Predictions human pricing
NM_012990 Rosetta Predictions rat pricing
NM_008711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158734 predicted 867
2 SASI_Hs01_00158735 predicted 874
3 SASI_Hs01_00158736 predicted 862
4 SASI_Hs01_00158738 predicted 789
5 SASI_Hs01_00158739 predicted 824
6 SASI_Hs01_00158740 predicted 861
7 SASI_Hs01_00158741 predicted 337
8 SASI_Hs01_00158742 predicted 837
9 SASI_Hs01_00158737 predicted 826
10 SASI_Hs01_00158743 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260623 predicted 458
2 SASI_Rn02_00260624 predicted 268
3 SASI_Rn02_00260625 predicted 818
4 SASI_Rn02_00260626 predicted 393
5 SASI_Rn02_00260627 predicted 335
6 SASI_Rn02_00260628 predicted 393
7 SASI_Rn02_00260629 predicted 403
8 SASI_Rn02_00260630 predicted 377
9 SASI_Rn02_00260631 predicted 420
10 SASI_Rn02_00260632 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115120 predicted 752
2 SASI_Mm01_00115121 predicted 748
3 SASI_Mm02_00314542 predicted 564
4 SASI_Mm02_00314543 predicted 630
5 SASI_Mm02_00314544 predicted 685
6 SASI_Mm02_00314545 predicted 692
7 SASI_Mm02_00314546 predicted 676
8 SASI_Mm02_00314547 predicted 715
9 SASI_Mm01_00115127 predicted 953
10 SASI_Mm02_00314548 predicted 935
11 SASI_Mm01_00115122 predicted 375
12 SASI_Mm01_00115123 predicted 376
13 SASI_Mm01_00115124 predicted 228
14 SASI_Mm01_00115125 predicted 377
15 SASI_Mm01_00115126 predicted 224
16 SASI_Mm01_00115128 predicted 465
17 SASI_Mm01_00115129 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005450
VALIDATED
NOG MISSION shRNA Bacterial Glycerol Stock
noggin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005450.4-1563s21c1
Sequence:CCGGATTCTGGTTGTTGCTAATAATCTCGAGATTATTAGCAACAACCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-988s1c1
Sequence:CCGGCGAGTGCAAGTGCTCGTGCTACTCGAGTAGCACGAGCACTTGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005450.2-676s1c1
Sequence:CCGGGCTAGAGTTCTCCGAGGGCTTCTCGAGAAGCCCTCGGAGAACTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-452s1c1
Sequence:CCGGGAACACCCAGACCCTATCTTTCTCGAGAAAGATAGGGTCTGGGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-978s1c1
Sequence:CCGGCCATCATTTCCGAGTGCAAGTCTCGAGACTTGCACTCGGAAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-877s1c1
Sequence:CCGGCATGGTGTGCAAGCCGTCCAACTCGAGTTGGACGGCTTGCACACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005450.4-1467s21c1
Sequence:CCGGAGGTCAGTATTATACGTTAAACTCGAGTTTAACGTATAATACTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005450.4-947s21c1
Sequence:CCGGTGCGGAGGAAGTTACAGATGTCTCGAGACATCTGTAACTTCCTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005450.4-869s21c1
Sequence:CCGGCCATGCCGAGCGAGATCAAAGCTCGAGCTTTGATCTCGCTCGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005450
VALIDATED
NOG MISSION shRNA shRNA Plasmid DNA
noggin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005450.4-1563s21c1
Sequence:CCGGATTCTGGTTGTTGCTAATAATCTCGAGATTATTAGCAACAACCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-988s1c1
Sequence:CCGGCGAGTGCAAGTGCTCGTGCTACTCGAGTAGCACGAGCACTTGCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005450.2-676s1c1
Sequence:CCGGGCTAGAGTTCTCCGAGGGCTTCTCGAGAAGCCCTCGGAGAACTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-452s1c1
Sequence:CCGGGAACACCCAGACCCTATCTTTCTCGAGAAAGATAGGGTCTGGGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-978s1c1
Sequence:CCGGCCATCATTTCCGAGTGCAAGTCTCGAGACTTGCACTCGGAAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-877s1c1
Sequence:CCGGCATGGTGTGCAAGCCGTCCAACTCGAGTTGGACGGCTTGCACACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005450.4-1467s21c1
Sequence:CCGGAGGTCAGTATTATACGTTAAACTCGAGTTTAACGTATAATACTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005450.4-947s21c1
Sequence:CCGGTGCGGAGGAAGTTACAGATGTCTCGAGACATCTGTAACTTCCTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005450.4-869s21c1
Sequence:CCGGCCATGCCGAGCGAGATCAAAGCTCGAGCTTTGATCTCGCTCGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005450
VALIDATED
NOG MISSION shRNA Lentiviral Transduction Particles
noggin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005450.4-1563s21c1
Sequence:CCGGATTCTGGTTGTTGCTAATAATCTCGAGATTATTAGCAACAACCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-988s1c1
Sequence:CCGGCGAGTGCAAGTGCTCGTGCTACTCGAGTAGCACGAGCACTTGCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005450.2-676s1c1
Sequence:CCGGGCTAGAGTTCTCCGAGGGCTTCTCGAGAAGCCCTCGGAGAACTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-452s1c1
Sequence:CCGGGAACACCCAGACCCTATCTTTCTCGAGAAAGATAGGGTCTGGGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-978s1c1
Sequence:CCGGCCATCATTTCCGAGTGCAAGTCTCGAGACTTGCACTCGGAAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005450.2-877s1c1
Sequence:CCGGCATGGTGTGCAAGCCGTCCAACTCGAGTTGGACGGCTTGCACACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005450.4-1467s21c1
Sequence:CCGGAGGTCAGTATTATACGTTAAACTCGAGTTTAACGTATAATACTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005450.4-947s21c1
Sequence:CCGGTGCGGAGGAAGTTACAGATGTCTCGAGACATCTGTAACTTCCTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005450.4-869s21c1
Sequence:CCGGCCATGCCGAGCGAGATCAAAGCTCGAGCTTTGATCTCGCTCGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008711
NOG MISSION shRNA Bacterial Glycerol Stock
noggin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-420s1c1
Sequence:CCGGGCTGAGGAGGAAGTTACAGATCTCGAGATCTGTAACTTCCTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-354s1c1
Sequence:CCGGCGAGATCAAAGGGCTGGAGTTCTCGAGAACTCCAGCCCTTTGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-165s1c1
Sequence:CCGGCCCTAAGGAGAAGGATCTGAACTCGAGTTCAGATCCTTCTCCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-78s1c1
Sequence:CCGGCGGCCAGCACTATCTACACATCTCGAGATGTGTAGATAGTGCTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-137s1c1
Sequence:CCGGTCATCGAACATCCAGACCCTACTCGAGTAGGGTCTGGATGTTCGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008711
NOG MISSION shRNA shRNA Plasmid DNA
noggin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-420s1c1
Sequence:CCGGGCTGAGGAGGAAGTTACAGATCTCGAGATCTGTAACTTCCTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-354s1c1
Sequence:CCGGCGAGATCAAAGGGCTGGAGTTCTCGAGAACTCCAGCCCTTTGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-165s1c1
Sequence:CCGGCCCTAAGGAGAAGGATCTGAACTCGAGTTCAGATCCTTCTCCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-78s1c1
Sequence:CCGGCGGCCAGCACTATCTACACATCTCGAGATGTGTAGATAGTGCTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-137s1c1
Sequence:CCGGTCATCGAACATCCAGACCCTACTCGAGTAGGGTCTGGATGTTCGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008711
NOG MISSION shRNA Lentiviral Transduction Particles
noggin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-420s1c1
Sequence:CCGGGCTGAGGAGGAAGTTACAGATCTCGAGATCTGTAACTTCCTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-354s1c1
Sequence:CCGGCGAGATCAAAGGGCTGGAGTTCTCGAGAACTCCAGCCCTTTGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-165s1c1
Sequence:CCGGCCCTAAGGAGAAGGATCTGAACTCGAGTTCAGATCCTTCTCCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-78s1c1
Sequence:CCGGCGGCCAGCACTATCTACACATCTCGAGATGTGTAGATAGTGCTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008711.1-137s1c1
Sequence:CCGGTCATCGAACATCCAGACCCTACTCGAGTAGGGTCTGGATGTTCGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)