EMAIL THIS PAGE TO A FRIEND

NOL10

nucleolar protein 10

60 Gene Product Result for
Synonyms: PQBP5
Gene ID:
Mouse(217431) nucleolar protein 10
Rat(313981) nucleolar protein 10
sheep(101118598) nucleolar protein 10
naked mole-rat(101698619) nucleolar protein 10
Domestic Rabbit(100345286) nucleolar protein 10
domestic guinea pig(100714905) nucleolar protein 10
Zebrafish(393206) nucleolar protein 10
cow(516314) nucleolar protein 10
Horse(100057037) nucleolar protein 10
domestic cat(101086899) nucleolar protein 10
dog(482966) nucleolar protein 10
chicken(421938) nucleolar protein 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024894 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001008421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024894 Rosetta Predictions human pricing
NM_001014076 Rosetta Predictions rat pricing
NM_001008421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203234 predicted 751
2 SASI_Hs01_00203237 predicted 352
3 SASI_Hs01_00203238 predicted 229
4 SASI_Hs01_00203240 predicted 291
5 SASI_Hs02_00357488 predicted 379
6 SASI_Hs01_00203241 predicted 2044
7 SASI_Hs01_00203242 predicted 2234
8 SASI_Hs01_00203243 predicted 1447
9 SASI_Hs02_00357489 predicted 1619
10 SASI_Hs02_00357490 predicted 813
11 SASI_Hs01_00203235 predicted 509
12 SASI_Hs01_00203236 predicted 359
13 SASI_Hs01_00203239 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069377 predicted 1081
2 SASI_Rn01_00069380 predicted 296
3 SASI_Rn01_00069381 predicted 1696
4 SASI_Rn01_00069382 predicted 739
5 SASI_Rn01_00069383 predicted 827
6 SASI_Rn01_00069385 predicted 957
7 SASI_Rn02_00201490 predicted 1568
8 SASI_Rn01_00069386 predicted 1027
9 SASI_Rn02_00201491 predicted 247
10 SASI_Rn02_00201492 predicted 1176
11 SASI_Rn01_00069378 predicted 410
12 SASI_Rn01_00069379 predicted 1932
13 SASI_Rn01_00069384 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286778 predicted 1068
2 SASI_Mm02_00286779 predicted 592
3 SASI_Mm02_00286780 predicted 950
4 SASI_Mm02_00286781 predicted 287
5 SASI_Mm02_00286782 predicted 862
6 SASI_Mm02_00286783 predicted 727
7 SASI_Mm02_00286784 predicted 1973
8 SASI_Mm02_00286785 predicted 1157
9 SASI_Mm02_00286786 predicted 1381
10 SASI_Mm02_00286787 predicted 1496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024894
VALIDATED
NOL10 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024894.1-3180s1c1
Sequence:CCGGCCCAACCTGTAATAATGGGAACTCGAGTTCCCATTATTACAGGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-892s1c1
Sequence:CCGGCCAGAGCATGACCTTAATGATCTCGAGATCATTAAGGTCATGCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-1945s1c1
Sequence:CCGGCTACATCGACAAGAAAGGAAACTCGAGTTTCCTTTCTTGTCGATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-343s1c1
Sequence:CCGGCGATGTTATGACACCTATCAACTCGAGTTGATAGGTGTCATAACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024894.1-2363s1c1
Sequence:CCGGCCAGAAACCAAGGTTTATCATCTCGAGATGATAAACCTTGGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024894.1-3181s1c1
Sequence:CCGGCCAACCTGTAATAATGGGAAACTCGAGTTTCCCATTATTACAGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-368s1c1
Sequence:CCGGCCTTGAAGTTTGAAAGGTGTTCTCGAGAACACCTTTCAAACTTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024894.1-2853s1c1
Sequence:CCGGGCACACTTTCAAACACCAGATCTCGAGATCTGGTGTTTGAAAGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024894.1-1936s1c1
Sequence:CCGGGCTGAGAAACTACATCGACAACTCGAGTTGTCGATGTAGTTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-1147s1c1
Sequence:CCGGCGGGCATATATGCATGGGTTTCTCGAGAAACCCATGCATATATGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024894
VALIDATED
NOL10 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024894.1-3180s1c1
Sequence:CCGGCCCAACCTGTAATAATGGGAACTCGAGTTCCCATTATTACAGGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-892s1c1
Sequence:CCGGCCAGAGCATGACCTTAATGATCTCGAGATCATTAAGGTCATGCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-1945s1c1
Sequence:CCGGCTACATCGACAAGAAAGGAAACTCGAGTTTCCTTTCTTGTCGATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-343s1c1
Sequence:CCGGCGATGTTATGACACCTATCAACTCGAGTTGATAGGTGTCATAACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024894.1-2363s1c1
Sequence:CCGGCCAGAAACCAAGGTTTATCATCTCGAGATGATAAACCTTGGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024894.1-3181s1c1
Sequence:CCGGCCAACCTGTAATAATGGGAAACTCGAGTTTCCCATTATTACAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-368s1c1
Sequence:CCGGCCTTGAAGTTTGAAAGGTGTTCTCGAGAACACCTTTCAAACTTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024894.1-2853s1c1
Sequence:CCGGGCACACTTTCAAACACCAGATCTCGAGATCTGGTGTTTGAAAGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024894.1-1936s1c1
Sequence:CCGGGCTGAGAAACTACATCGACAACTCGAGTTGTCGATGTAGTTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-1147s1c1
Sequence:CCGGCGGGCATATATGCATGGGTTTCTCGAGAAACCCATGCATATATGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024894
VALIDATED
NOL10 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024894.1-3180s1c1
Sequence:CCGGCCCAACCTGTAATAATGGGAACTCGAGTTCCCATTATTACAGGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-892s1c1
Sequence:CCGGCCAGAGCATGACCTTAATGATCTCGAGATCATTAAGGTCATGCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-1945s1c1
Sequence:CCGGCTACATCGACAAGAAAGGAAACTCGAGTTTCCTTTCTTGTCGATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-343s1c1
Sequence:CCGGCGATGTTATGACACCTATCAACTCGAGTTGATAGGTGTCATAACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024894.1-2363s1c1
Sequence:CCGGCCAGAAACCAAGGTTTATCATCTCGAGATGATAAACCTTGGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024894.1-3181s1c1
Sequence:CCGGCCAACCTGTAATAATGGGAAACTCGAGTTTCCCATTATTACAGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-368s1c1
Sequence:CCGGCCTTGAAGTTTGAAAGGTGTTCTCGAGAACACCTTTCAAACTTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024894.1-2853s1c1
Sequence:CCGGGCACACTTTCAAACACCAGATCTCGAGATCTGGTGTTTGAAAGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024894.1-1936s1c1
Sequence:CCGGGCTGAGAAACTACATCGACAACTCGAGTTGTCGATGTAGTTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024894.1-1147s1c1
Sequence:CCGGCGGGCATATATGCATGGGTTTCTCGAGAAACCCATGCATATATGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008421
VALIDATED
NOL10 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008421.1-1247s1c1
Sequence:CCGGCGAGCATATATGCATGGGTTTCTCGAGAAACCCATGCATATATGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008421.1-522s1c1
Sequence:CCGGCAAGCTCTGAAGTTTATAGATCTCGAGATCTATAAACTTCAGAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008421.1-1981s1c1
Sequence:CCGGGCAGTTGACATTTACTCTCAACTCGAGTTGAGAGTAAATGTCAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-1159s1c1
Sequence:CCGGGAGCACAGTGTATGATGATTACTCGAGTAATCATCATACACTGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008421.1-2361s1c1
Sequence:CCGGGCATCATTTCAGATATTGGAACTCGAGTTCCAATATCTGAAATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-290s1c1
Sequence:CCGGGTCCGGTGTTATGACACATATCTCGAGATATGTGTCATAACACCGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-1384s1c1
Sequence:CCGGCCAATTAAAGAAACTGCCAAACTCGAGTTTGGCAGTTTCTTTAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-697s1c1
Sequence:CCGGCGTGTTAGACTGTGCATTAAACTCGAGTTTAATGCACAGTCTAACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008421
VALIDATED
NOL10 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008421.1-1247s1c1
Sequence:CCGGCGAGCATATATGCATGGGTTTCTCGAGAAACCCATGCATATATGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008421.1-522s1c1
Sequence:CCGGCAAGCTCTGAAGTTTATAGATCTCGAGATCTATAAACTTCAGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008421.1-1981s1c1
Sequence:CCGGGCAGTTGACATTTACTCTCAACTCGAGTTGAGAGTAAATGTCAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-1159s1c1
Sequence:CCGGGAGCACAGTGTATGATGATTACTCGAGTAATCATCATACACTGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008421.1-2361s1c1
Sequence:CCGGGCATCATTTCAGATATTGGAACTCGAGTTCCAATATCTGAAATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-290s1c1
Sequence:CCGGGTCCGGTGTTATGACACATATCTCGAGATATGTGTCATAACACCGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-1384s1c1
Sequence:CCGGCCAATTAAAGAAACTGCCAAACTCGAGTTTGGCAGTTTCTTTAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-697s1c1
Sequence:CCGGCGTGTTAGACTGTGCATTAAACTCGAGTTTAATGCACAGTCTAACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008421
VALIDATED
NOL10 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008421.1-1247s1c1
Sequence:CCGGCGAGCATATATGCATGGGTTTCTCGAGAAACCCATGCATATATGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008421.1-522s1c1
Sequence:CCGGCAAGCTCTGAAGTTTATAGATCTCGAGATCTATAAACTTCAGAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008421.1-1981s1c1
Sequence:CCGGGCAGTTGACATTTACTCTCAACTCGAGTTGAGAGTAAATGTCAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-1159s1c1
Sequence:CCGGGAGCACAGTGTATGATGATTACTCGAGTAATCATCATACACTGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008421.1-2361s1c1
Sequence:CCGGGCATCATTTCAGATATTGGAACTCGAGTTCCAATATCTGAAATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-290s1c1
Sequence:CCGGGTCCGGTGTTATGACACATATCTCGAGATATGTGTCATAACACCGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-1384s1c1
Sequence:CCGGCCAATTAAAGAAACTGCCAAACTCGAGTTTGGCAGTTTCTTTAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008421.1-697s1c1
Sequence:CCGGCGTGTTAGACTGTGCATTAAACTCGAGTTTAATGCACAGTCTAACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)