EMAIL THIS PAGE TO A FRIEND

NOL4

nucleolar protein 4

75 Gene Product Result for
Synonyms: CT125 NOLP
UniProtKB ID: O94818, B4DSQ0, B7Z3Z7, F5H1E3, Q6IBS2, Q9BWF1
Gene ID:
Mouse(319211) nucleolar protein 4
Rat(307553) nucleolar protein 4
sheep(101112868) nucleolar protein 4
naked mole-rat(101701404) nucleolar protein 4
Domestic Rabbit(100350251) nucleolar protein 4
domestic guinea pig(100714229) nucleolar protein 4
chicken(769466) nucleolar protein 4
domestic cat(101089651) nucleolar protein 4
cow(536981) nucleolar protein 4
Horse(100052509) nucleolar protein 4
dog(490491) nucleolar protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40492 Anti-NOL4 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
WH0008715M1 Monoclonal Anti-NOL4 antibody produced in mouse clone 2A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003787 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003787 Rosetta Predictions human pricing
NM_001107401 Rosetta Predictions rat pricing
NM_199024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336290 predicted 762
2 SASI_Hs01_00159575 predicted 991
3 SASI_Hs01_00159576 predicted 2220
4 SASI_Hs01_00159577 predicted 1880
5 SASI_Hs01_00159578 predicted 1398
6 SASI_Hs02_00336291 predicted 1462
7 SASI_Hs01_00159580 predicted 1577
8 SASI_Hs01_00159581 predicted 1591
9 SASI_Hs01_00159582 predicted 1819
10 SASI_Hs02_00336292 predicted 788
11 SASI_Hs01_00159573 predicted 715
12 SASI_Hs01_00159574 predicted 2295
13 SASI_Hs01_00159579 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228455 predicted 2590
2 SASI_Rn02_00228456 predicted 3342
3 SASI_Rn02_00228457 predicted 2827
4 SASI_Rn02_00228458 predicted 2200
5 SASI_Rn02_00228459 predicted 1963
6 SASI_Rn02_00228460 predicted 3102
7 SASI_Rn02_00228461 predicted 2266
8 SASI_Rn02_00228462 predicted 1700
9 SASI_Rn02_00228463 predicted 1740
10 SASI_Rn02_00228464 predicted 3005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092610 predicted 820
2 SASI_Mm01_00092611 predicted 1052
3 SASI_Mm01_00092612 predicted 1754
4 SASI_Mm01_00092613 predicted 1179
5 SASI_Mm01_00092614 predicted 421
6 SASI_Mm02_00351280 predicted 779
7 SASI_Mm01_00092616 predicted 236
8 SASI_Mm01_00092617 predicted 1115
9 SASI_Mm01_00092618 predicted 1792
10 SASI_Mm01_00092619 predicted 397
11 SASI_Mm01_00092615 predicted 1814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003787
NOL4 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003787.3-302s21c1
Sequence:CCGGACCAAGACGGTGACCCGTAAACTCGAGTTTACGGGTCACCGTCTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2362s1c1
Sequence:CCGGGATCCGTAAGTGATGTGTTAACTCGAGTTAACACATCACTTACGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003787.1-813s1c1
Sequence:CCGGCCAGATGGAACAGATCATAAACTCGAGTTTATGATCTGTTCCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2238s1c1
Sequence:CCGGCCATATTCACTGAGGTCTAAACTCGAGTTTAGACCTCAGTGAATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003787.3-1398s21c1
Sequence:CCGGACCATGACGATTCGGAGAAAGCTCGAGCTTTCTCCGAATCGTCATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2262s1c1
Sequence:CCGGGCAGTTCCACTAATGACATTTCTCGAGAAATGTCATTAGTGGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003787.3-1552s21c1
Sequence:CCGGTGACTCATGCAGGCGACAATTCTCGAGAATTGTCGCCTGCATGAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2424s1c1
Sequence:CCGGCTTTAGTATGTCCAGCCTATTCTCGAGAATAGGCTGGACATACTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003787.1-1024s1c1
Sequence:CCGGGCTCCAATCTTGAAGAAAGAACTCGAGTTCTTTCTTCAAGATTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003787.1-716s1c1
Sequence:CCGGCAAAGCAATTTCAGAGAGCTACTCGAGTAGCTCTCTGAAATTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003787
NOL4 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003787.3-302s21c1
Sequence:CCGGACCAAGACGGTGACCCGTAAACTCGAGTTTACGGGTCACCGTCTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2362s1c1
Sequence:CCGGGATCCGTAAGTGATGTGTTAACTCGAGTTAACACATCACTTACGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003787.1-813s1c1
Sequence:CCGGCCAGATGGAACAGATCATAAACTCGAGTTTATGATCTGTTCCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2238s1c1
Sequence:CCGGCCATATTCACTGAGGTCTAAACTCGAGTTTAGACCTCAGTGAATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003787.3-1398s21c1
Sequence:CCGGACCATGACGATTCGGAGAAAGCTCGAGCTTTCTCCGAATCGTCATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2262s1c1
Sequence:CCGGGCAGTTCCACTAATGACATTTCTCGAGAAATGTCATTAGTGGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003787.3-1552s21c1
Sequence:CCGGTGACTCATGCAGGCGACAATTCTCGAGAATTGTCGCCTGCATGAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2424s1c1
Sequence:CCGGCTTTAGTATGTCCAGCCTATTCTCGAGAATAGGCTGGACATACTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003787.1-1024s1c1
Sequence:CCGGGCTCCAATCTTGAAGAAAGAACTCGAGTTCTTTCTTCAAGATTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003787.1-716s1c1
Sequence:CCGGCAAAGCAATTTCAGAGAGCTACTCGAGTAGCTCTCTGAAATTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003787
NOL4 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003787.3-302s21c1
Sequence:CCGGACCAAGACGGTGACCCGTAAACTCGAGTTTACGGGTCACCGTCTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2362s1c1
Sequence:CCGGGATCCGTAAGTGATGTGTTAACTCGAGTTAACACATCACTTACGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003787.1-813s1c1
Sequence:CCGGCCAGATGGAACAGATCATAAACTCGAGTTTATGATCTGTTCCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2238s1c1
Sequence:CCGGCCATATTCACTGAGGTCTAAACTCGAGTTTAGACCTCAGTGAATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003787.3-1398s21c1
Sequence:CCGGACCATGACGATTCGGAGAAAGCTCGAGCTTTCTCCGAATCGTCATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2262s1c1
Sequence:CCGGGCAGTTCCACTAATGACATTTCTCGAGAAATGTCATTAGTGGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003787.3-1552s21c1
Sequence:CCGGTGACTCATGCAGGCGACAATTCTCGAGAATTGTCGCCTGCATGAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003787.1-2424s1c1
Sequence:CCGGCTTTAGTATGTCCAGCCTATTCTCGAGAATAGGCTGGACATACTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003787.1-1024s1c1
Sequence:CCGGGCTCCAATCTTGAAGAAAGAACTCGAGTTCTTTCTTCAAGATTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003787.1-716s1c1
Sequence:CCGGCAAAGCAATTTCAGAGAGCTACTCGAGTAGCTCTCTGAAATTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199024
NOL4 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-1332s1c1
Sequence:CCGGCGAGAGTAGAAATGCTGCCAACTCGAGTTGGCAGCATTTCTACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-483s1c1
Sequence:CCGGCTCAATAGAAAGTGACGAATTCTCGAGAATTCGTCACTTTCTATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199024.1-2019s1c1
Sequence:CCGGGCCTGGATATTCTTAATTCAACTCGAGTTGAATTAAGAATATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-482s1c1
Sequence:CCGGGCTCAATAGAAAGTGACGAATCTCGAGATTCGTCACTTTCTATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-1117s1c1
Sequence:CCGGCCAATCTCTAAGCAGCCCAAACTCGAGTTTGGGCTGCTTAGAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199024
NOL4 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-1332s1c1
Sequence:CCGGCGAGAGTAGAAATGCTGCCAACTCGAGTTGGCAGCATTTCTACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-483s1c1
Sequence:CCGGCTCAATAGAAAGTGACGAATTCTCGAGAATTCGTCACTTTCTATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199024.1-2019s1c1
Sequence:CCGGGCCTGGATATTCTTAATTCAACTCGAGTTGAATTAAGAATATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-482s1c1
Sequence:CCGGGCTCAATAGAAAGTGACGAATCTCGAGATTCGTCACTTTCTATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-1117s1c1
Sequence:CCGGCCAATCTCTAAGCAGCCCAAACTCGAGTTTGGGCTGCTTAGAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199024
NOL4 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-1332s1c1
Sequence:CCGGCGAGAGTAGAAATGCTGCCAACTCGAGTTGGCAGCATTTCTACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-483s1c1
Sequence:CCGGCTCAATAGAAAGTGACGAATTCTCGAGAATTCGTCACTTTCTATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199024.1-2019s1c1
Sequence:CCGGGCCTGGATATTCTTAATTCAACTCGAGTTGAATTAAGAATATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-482s1c1
Sequence:CCGGGCTCAATAGAAAGTGACGAATCTCGAGATTCGTCACTTTCTATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199024.1-1117s1c1
Sequence:CCGGCCAATCTCTAAGCAGCCCAAACTCGAGTTTGGGCTGCTTAGAGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)