EMAIL THIS PAGE TO A FRIEND

NOL6

nucleolar protein 6 (RNA-associated)

79 Gene Product Result for
Synonyms: NRAP UTP22 bA311H10.1
Gene ID:
Human(65083) Summary: The nucleolus is a dense subnuclear membraneless organelle that assembles around clusters of rRNA genes and functions in ribosome biogenesis. This gene encodes a nucleolar RNA-associated protein that is highly conserved between species. RNase treatment of permeabilized cells indicates that the nucleolar localization is RNA dependent. Further studies suggest that the protein is associated with ribosome biogenesis through an interaction with pre-rRNA primary transcripts. Alternative splicing has been observed at this locus and two splice variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(230082) nucleolar protein family 6 (RNA-associated)
Rat(313167) nucleolar protein 6 (RNA-associated)
Zebrafish(334362) nucleolar protein family 6 (RNA-associated)
chicken(426441) nucleolar protein family 6 (RNA-associated)
cow(782674) nucleolar protein family 6 (RNA-associated)
Horse(100053901) nucleolar protein family 6 (RNA-associated)
domestic cat(101080490) nucleolar protein family 6 (RNA-associated)
dog(481582) nucleolar protein family 6 (RNA-associated)
chicken(100858366) nucleolar protein 6 (RNA-associated)
domestic guinea pig(100724103) nucleolar protein 6 (RNA-associated)
naked mole-rat(101696440) nucleolar protein 6 (RNA-associated)
sheep(101103292) nucleolar protein family 6 (RNA-associated)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022917 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139237 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139237 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139237 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022917 Rosetta Predictions human pricing
NM_130793 Rosetta Predictions human pricing
NM_139235 Rosetta Predictions human pricing
NM_001107927 Rosetta Predictions rat pricing
NM_139236 Rosetta Predictions mouse pricing
NM_139237 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198826 predicted 1818
2 SASI_Hs01_00198827 predicted 1220
3 SASI_Hs01_00198828 predicted 284
4 SASI_Hs01_00198829 predicted 1714
5 SASI_Hs01_00198830 predicted 1389
6 SASI_Hs01_00198831 predicted 345
7 SASI_Hs01_00198832 predicted 380
8 SASI_Hs01_00198833 predicted 1035
9 SASI_Hs01_00198834 predicted 1231
10 SASI_Hs01_00198835 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102600 predicted 1831
2 SASI_Hs01_00102601 predicted 1228
3 SASI_Hs01_00102602 predicted 287
4 SASI_Hs01_00102603 predicted 1719
5 SASI_Hs01_00102604 predicted 1397
6 SASI_Hs01_00102605 predicted 345
7 SASI_Hs01_00102606 predicted 378
8 SASI_Hs01_00102607 predicted 1036
9 SASI_Hs01_00102608 predicted 1235
10 SASI_Hs01_00102609 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083750 predicted 1821
2 SASI_Hs01_00083751 predicted 1217
3 SASI_Hs01_00083752 predicted 288
4 SASI_Hs01_00083753 predicted 1711
5 SASI_Hs01_00083754 predicted 1390
6 SASI_Hs01_00083755 predicted 341
7 SASI_Hs01_00083756 predicted 376
8 SASI_Hs01_00083757 predicted 1036
9 SASI_Hs01_00083758 predicted 1233
10 SASI_Hs01_00083759 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233655 predicted 807
2 SASI_Rn02_00233656 predicted 931
3 SASI_Rn02_00233657 predicted 1090
4 SASI_Rn02_00233658 predicted 1543
5 SASI_Rn02_00233659 predicted 1356
6 SASI_Rn02_00233660 predicted 1685
7 SASI_Rn02_00233661 predicted 2589
8 SASI_Rn02_00233662 predicted 1494
9 SASI_Rn02_00233663 predicted 265
10 SASI_Rn02_00233664 predicted 2482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165975 predicted 2143
2 SASI_Mm02_00339960 predicted 218
3 SASI_Mm01_00165976 predicted 1404
4 SASI_Mm01_00165978 predicted 1456
5 SASI_Mm01_00165979 predicted 297
6 SASI_Mm01_00165980 predicted 1278
7 SASI_Mm01_00165981 predicted 2516
8 SASI_Mm01_00165982 predicted 269
9 SASI_Mm01_00165983 predicted 1470
10 SASI_Mm02_00339961 predicted 1928
11 SASI_Mm01_00165974 predicted 371
12 SASI_Mm01_00165977 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126137 predicted 371
2 SASI_Mm01_00126138 predicted 2105
3 SASI_Mm01_00126139 predicted 1354
4 SASI_Mm01_00126140 predicted 263
5 SASI_Mm01_00126141 predicted 1410
6 SASI_Mm01_00126142 predicted 246
7 SASI_Mm01_00126143 predicted 1234
8 SASI_Mm01_00126144 predicted 2474
9 SASI_Mm01_00126145 predicted 223
10 SASI_Mm01_00126146 predicted 1423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022917
NOL6 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 6 (RNA-associated)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022917.4-291s21c1
Sequence:CCGGCCTACCAATGAGGAGCTTAATCTCGAGATTAAGCTCCTCATTGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022917.4-3813s21c1
Sequence:CCGGAGGAGATCCATCCACCTATTACTCGAGTAATAGGTGGATGGATCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022917.4-339s21c1
Sequence:CCGGCACTCCAGCTTGCTTCGTTTACTCGAGTAAACGAAGCAAGCTGGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-1989s1c1
Sequence:CCGGCCAGAAACCTGTGTCCACTATCTCGAGATAGTGGACACAGGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-408s1c1
Sequence:CCGGGATCGGATTGATGCCTTCCTACTCGAGTAGGAAGGCATCAATCCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-2849s1c1
Sequence:CCGGCCTCTTTGTCAACCTCAATAACTCGAGTTATTGAGGTTGACAAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-3435s1c1
Sequence:CCGGGAGCTAGTAATGGTGCCCAATCTCGAGATTGGGCACCATTACTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022917.4-396s1c1
Sequence:CCGGGAGAAGAAGAAGGATCGGATTCTCGAGAATCCGATCCTTCTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022917.4-4533s1c1
Sequence:CCGGGCAGTTACTGTCTGTTCAGTTCTCGAGAACTGAACAGACAGTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-2466s1c1
Sequence:CCGGGATGGATTTGTGTTTCGGATTCTCGAGAATCCGAAACACAAATCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022917
NOL6 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 6 (RNA-associated)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022917.4-291s21c1
Sequence:CCGGCCTACCAATGAGGAGCTTAATCTCGAGATTAAGCTCCTCATTGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022917.4-3813s21c1
Sequence:CCGGAGGAGATCCATCCACCTATTACTCGAGTAATAGGTGGATGGATCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022917.4-339s21c1
Sequence:CCGGCACTCCAGCTTGCTTCGTTTACTCGAGTAAACGAAGCAAGCTGGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-1989s1c1
Sequence:CCGGCCAGAAACCTGTGTCCACTATCTCGAGATAGTGGACACAGGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-408s1c1
Sequence:CCGGGATCGGATTGATGCCTTCCTACTCGAGTAGGAAGGCATCAATCCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-2849s1c1
Sequence:CCGGCCTCTTTGTCAACCTCAATAACTCGAGTTATTGAGGTTGACAAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-3435s1c1
Sequence:CCGGGAGCTAGTAATGGTGCCCAATCTCGAGATTGGGCACCATTACTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022917.4-396s1c1
Sequence:CCGGGAGAAGAAGAAGGATCGGATTCTCGAGAATCCGATCCTTCTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022917.4-4533s1c1
Sequence:CCGGGCAGTTACTGTCTGTTCAGTTCTCGAGAACTGAACAGACAGTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-2466s1c1
Sequence:CCGGGATGGATTTGTGTTTCGGATTCTCGAGAATCCGAAACACAAATCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022917
NOL6 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 6 (RNA-associated)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022917.4-291s21c1
Sequence:CCGGCCTACCAATGAGGAGCTTAATCTCGAGATTAAGCTCCTCATTGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022917.4-3813s21c1
Sequence:CCGGAGGAGATCCATCCACCTATTACTCGAGTAATAGGTGGATGGATCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022917.4-339s21c1
Sequence:CCGGCACTCCAGCTTGCTTCGTTTACTCGAGTAAACGAAGCAAGCTGGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-1989s1c1
Sequence:CCGGCCAGAAACCTGTGTCCACTATCTCGAGATAGTGGACACAGGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-408s1c1
Sequence:CCGGGATCGGATTGATGCCTTCCTACTCGAGTAGGAAGGCATCAATCCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-2849s1c1
Sequence:CCGGCCTCTTTGTCAACCTCAATAACTCGAGTTATTGAGGTTGACAAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-3435s1c1
Sequence:CCGGGAGCTAGTAATGGTGCCCAATCTCGAGATTGGGCACCATTACTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022917.4-396s1c1
Sequence:CCGGGAGAAGAAGAAGGATCGGATTCTCGAGAATCCGATCCTTCTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022917.4-4533s1c1
Sequence:CCGGGCAGTTACTGTCTGTTCAGTTCTCGAGAACTGAACAGACAGTAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022917.4-2466s1c1
Sequence:CCGGGATGGATTTGTGTTTCGGATTCTCGAGAATCCGAAACACAAATCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139236
VALIDATED
NOL6 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 6 (RNA-associated)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000326903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139236.3-1267s21c1
Sequence:CCGGCGATCTGACAATCAATGGAATCTCGAGATTCCATTGATTGTCAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139236.3-4378s21c1
Sequence:CCGGGCGATTATTCCTTGTCGAGTTCTCGAGAACTCGACAAGGAATAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139236.3-1182s21c1
Sequence:CCGGCCTTCCTGGTATCTAAACGAACTCGAGTTCGTTTAGATACCAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139236.3-1141s21c1
Sequence:CCGGCCTGGGTGGATTTAACGGATTCTCGAGAATCCGTTAAATCCACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139236
VALIDATED
NOL6 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 6 (RNA-associated)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000326903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139236.3-1267s21c1
Sequence:CCGGCGATCTGACAATCAATGGAATCTCGAGATTCCATTGATTGTCAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139236.3-4378s21c1
Sequence:CCGGGCGATTATTCCTTGTCGAGTTCTCGAGAACTCGACAAGGAATAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139236.3-1182s21c1
Sequence:CCGGCCTTCCTGGTATCTAAACGAACTCGAGTTCGTTTAGATACCAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139236.3-1141s21c1
Sequence:CCGGCCTGGGTGGATTTAACGGATTCTCGAGAATCCGTTAAATCCACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139236
VALIDATED
NOL6 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 6 (RNA-associated)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000326903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139236.3-1267s21c1
Sequence:CCGGCGATCTGACAATCAATGGAATCTCGAGATTCCATTGATTGTCAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139236.3-4378s21c1
Sequence:CCGGGCGATTATTCCTTGTCGAGTTCTCGAGAACTCGACAAGGAATAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139236.3-1182s21c1
Sequence:CCGGCCTTCCTGGTATCTAAACGAACTCGAGTTCGTTTAGATACCAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139236.3-1141s21c1
Sequence:CCGGCCTGGGTGGATTTAACGGATTCTCGAGAATCCGTTAAATCCACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139237
VALIDATED
NOL6 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 6 (RNA-associated)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139237.1-1090s1c1
Sequence:CCGGCCTGGGTGGATTTAACGGATTCTCGAGAATCCGTTAAATCCACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139237.1-323s1c1
Sequence:CCGGCGTTTACAAGTGGAGGAGTTACTCGAGTAACTCCTCCACTTGTAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139237.1-1131s1c1
Sequence:CCGGCCTTCCTGGTATCTAAACGAACTCGAGTTCGTTTAGATACCAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139237.1-1216s1c1
Sequence:CCGGCGATCTGACAATCAATGGAATCTCGAGATTCCATTGATTGTCAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139237.1-3251s1c1
Sequence:CCGGGCGATTATTCCTTGTCGAGTTCTCGAGAACTCGACAAGGAATAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139237
VALIDATED
NOL6 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 6 (RNA-associated)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139237.1-1090s1c1
Sequence:CCGGCCTGGGTGGATTTAACGGATTCTCGAGAATCCGTTAAATCCACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139237.1-323s1c1
Sequence:CCGGCGTTTACAAGTGGAGGAGTTACTCGAGTAACTCCTCCACTTGTAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139237.1-1131s1c1
Sequence:CCGGCCTTCCTGGTATCTAAACGAACTCGAGTTCGTTTAGATACCAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139237.1-1216s1c1
Sequence:CCGGCGATCTGACAATCAATGGAATCTCGAGATTCCATTGATTGTCAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139237.1-3251s1c1
Sequence:CCGGGCGATTATTCCTTGTCGAGTTCTCGAGAACTCGACAAGGAATAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139237
VALIDATED
NOL6 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 6 (RNA-associated)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139237.1-1090s1c1
Sequence:CCGGCCTGGGTGGATTTAACGGATTCTCGAGAATCCGTTAAATCCACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139237.1-323s1c1
Sequence:CCGGCGTTTACAAGTGGAGGAGTTACTCGAGTAACTCCTCCACTTGTAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139237.1-1131s1c1
Sequence:CCGGCCTTCCTGGTATCTAAACGAACTCGAGTTCGTTTAGATACCAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139237.1-1216s1c1
Sequence:CCGGCGATCTGACAATCAATGGAATCTCGAGATTCCATTGATTGTCAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139237.1-3251s1c1
Sequence:CCGGGCGATTATTCCTTGTCGAGTTCTCGAGAACTCGACAAGGAATAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)