EMAIL THIS PAGE TO A FRIEND

NOL7

nucleolar protein 7, 27kDa

53 Gene Product Result for
Synonyms: C6orf90 PQBP3 RARG-1 dJ223E5.2
UniProtKB ID: Q9UMY1, Q5T297, Q9Y3U7
Gene ID:
Mouse(70078) nucleolar protein 7
Rat(498727) nucleolar protein 7
sheep(101103849) nucleolar protein 7, 27kDa
naked mole-rat(101718550) nucleolar protein 7, 27kDa
domestic guinea pig(100727030) nucleolar protein 7, 27kDa
Zebrafish(558911) nucleolar protein 7
chicken(420835) nucleolar protein 7, 27kDa
dog(478727) nucleolar protein 7, 27kDa
cow(510511) nucleolar protein 7, 27kDa
domestic cat(101089611) nucleolar protein 7, 27kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016167 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU076901 MISSION® esiRNA esiRNA targeting mouse Nol7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016167 Rosetta Predictions human pricing
XM_001060437 Rosetta Predictions rat pricing
XM_573999 Rosetta Predictions rat pricing
NM_023554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053328 predicted 330
2 SASI_Hs02_00348981 predicted 496
3 SASI_Hs02_00348982 predicted 392
4 SASI_Hs01_00053330 predicted 402
5 SASI_Hs01_00053331 predicted 319
6 SASI_Hs01_00053332 predicted 489
7 SASI_Hs01_00053333 predicted 332
8 SASI_Hs01_00053334 predicted 334
9 SASI_Hs01_00053335 predicted 359
10 SASI_Hs01_00053336 predicted 383
11 SASI_Hs01_00053329 predicted 439
12 SASI_Hs01_00053337 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296514 predicted 1144
2 SASI_Rn02_00296515 predicted 287
3 SASI_Rn02_00296516 predicted 1154
4 SASI_Rn02_00296517 predicted 1173
5 SASI_Rn02_00296518 predicted 1354
6 SASI_Rn02_00296519 predicted 1372
7 SASI_Rn02_00296520 predicted 1084
8 SASI_Rn02_00296521 predicted 1301
9 SASI_Rn02_00296522 predicted 1282
10 SASI_Rn02_00296523 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401180 predicted 285
2 SASI_Rn02_00401181 predicted 233
3 SASI_Rn02_00401182 predicted 340
4 SASI_Rn02_00401183 predicted 338
5 SASI_Rn02_00401184 predicted 385
6 SASI_Rn02_00401185 predicted 482
7 SASI_Rn02_00401186 predicted 233
8 SASI_Rn02_00401187 predicted 341
9 SASI_Rn02_00401188 predicted 396
10 SASI_Rn02_00401189 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163725 predicted 387
2 SASI_Mm01_00163726 predicted 852
3 SASI_Mm01_00163727 predicted 889
4 SASI_Mm01_00163728 predicted 352
5 SASI_Mm01_00163729 predicted 466
6 SASI_Mm02_00327187 predicted 473
7 SASI_Mm01_00163731 predicted 778
8 SASI_Mm01_00163732 predicted 783
9 SASI_Mm01_00163733 predicted 468
10 SASI_Mm01_00163734 predicted 880
11 SASI_Mm01_00163730 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023554
NOL7 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 7, 27kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-310s1c1
Sequence:CCGGGAGCTGTTCATCGAACAAGAACTCGAGTTCTTGTTCGATGAACAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-280s1c1
Sequence:CCGGCTGTTGAAGGAGAAGAGGAAACTCGAGTTTCCTCTTCTCCTTCAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023554.1-1098s1c1
Sequence:CCGGCCTGTTGTCAAGGAATAAGAACTCGAGTTCTTATTCCTTGACAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023554.1-1518s1c1
Sequence:CCGGGCAGTTACCTAAAGGTAGTTTCTCGAGAAACTACCTTTAGGTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-347s1c1
Sequence:CCGGGATGCTGTATTAGAGCAGCTACTCGAGTAGCTGCTCTAATACAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-385s1c1
Sequence:CCGGCGACATAAAGAAATCACCAGACTCGAGTCTGGTGATTTCTTTATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023554.1-1567s1c1
Sequence:CCGGGCAGTATATGAGAACCTAATACTCGAGTATTAGGTTCTCATATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.2-472s1c1
Sequence:CCGGGAAACTCCAAGAAAGTTAAAGCTCGAGCTTTAACTTTCTTGGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.2-793s1c1
Sequence:CCGGGAATCAAAGTCAAGTGAAATGCTCGAGCATTTCACTTGACTTTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.2-530s1c1
Sequence:CCGGCATGGCTGTAAGGCTTAAAGACTCGAGTCTTTAAGCCTTACAGCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023554
NOL7 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 7, 27kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-310s1c1
Sequence:CCGGGAGCTGTTCATCGAACAAGAACTCGAGTTCTTGTTCGATGAACAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-280s1c1
Sequence:CCGGCTGTTGAAGGAGAAGAGGAAACTCGAGTTTCCTCTTCTCCTTCAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023554.1-1098s1c1
Sequence:CCGGCCTGTTGTCAAGGAATAAGAACTCGAGTTCTTATTCCTTGACAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023554.1-1518s1c1
Sequence:CCGGGCAGTTACCTAAAGGTAGTTTCTCGAGAAACTACCTTTAGGTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-347s1c1
Sequence:CCGGGATGCTGTATTAGAGCAGCTACTCGAGTAGCTGCTCTAATACAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-385s1c1
Sequence:CCGGCGACATAAAGAAATCACCAGACTCGAGTCTGGTGATTTCTTTATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023554.1-1567s1c1
Sequence:CCGGGCAGTATATGAGAACCTAATACTCGAGTATTAGGTTCTCATATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.2-472s1c1
Sequence:CCGGGAAACTCCAAGAAAGTTAAAGCTCGAGCTTTAACTTTCTTGGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.2-793s1c1
Sequence:CCGGGAATCAAAGTCAAGTGAAATGCTCGAGCATTTCACTTGACTTTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.2-530s1c1
Sequence:CCGGCATGGCTGTAAGGCTTAAAGACTCGAGTCTTTAAGCCTTACAGCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023554
NOL7 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 7, 27kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-310s1c1
Sequence:CCGGGAGCTGTTCATCGAACAAGAACTCGAGTTCTTGTTCGATGAACAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-280s1c1
Sequence:CCGGCTGTTGAAGGAGAAGAGGAAACTCGAGTTTCCTCTTCTCCTTCAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023554.1-1098s1c1
Sequence:CCGGCCTGTTGTCAAGGAATAAGAACTCGAGTTCTTATTCCTTGACAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023554.1-1518s1c1
Sequence:CCGGGCAGTTACCTAAAGGTAGTTTCTCGAGAAACTACCTTTAGGTAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-347s1c1
Sequence:CCGGGATGCTGTATTAGAGCAGCTACTCGAGTAGCTGCTCTAATACAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.1-385s1c1
Sequence:CCGGCGACATAAAGAAATCACCAGACTCGAGTCTGGTGATTTCTTTATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023554.1-1567s1c1
Sequence:CCGGGCAGTATATGAGAACCTAATACTCGAGTATTAGGTTCTCATATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.2-472s1c1
Sequence:CCGGGAAACTCCAAGAAAGTTAAAGCTCGAGCTTTAACTTTCTTGGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.2-793s1c1
Sequence:CCGGGAATCAAAGTCAAGTGAAATGCTCGAGCATTTCACTTGACTTTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023554.2-530s1c1
Sequence:CCGGCATGGCTGTAAGGCTTAAAGACTCGAGTCTTTAAGCCTTACAGCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016167
VALIDATED
NOL7 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 7, 27kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-519s1c1
Sequence:CCGGGTACAGTCTGTCAGCCAGAATCTCGAGATTCTGGCTGACAGACTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-390s1c1
Sequence:CCGGGAGAAGTTAACCACAGCTTCACTCGAGTGAAGCTGTGGTTAACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-573s1c1
Sequence:CCGGGATCTGAGAGATTCAAGGCAACTCGAGTTGCCTTGAATCTCTCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-640s1c1
Sequence:CCGGCCAACAGGACTACTGTAAATACTCGAGTATTTACAGTAGTCCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-341s1c1
Sequence:CCGGGCTGTTCATCGAACAGAAGAACTCGAGTTCTTCTGTTCGATGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-401s1c1
Sequence:CCGGCACAGCTTCACAGACTAACATCTCGAGATGTTAGTCTGTGAAGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-431s1c1
Sequence:CCGGGCCAGGAAAGGTGAAAGAAGTCTCGAGACTTCTTTCACCTTTCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-545s1c1
Sequence:CCGGCTACTTGGCCGTAAGGCTAAACTCGAGTTTAGCCTTACGGCCAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-662s1c1
Sequence:CCGGGTTCCTGTCTCTTGCCAACAACTCGAGTTGTTGGCAAGAGACAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-597s1c1
Sequence:CCGGGCAGCACAAGCCTTCATACATCTCGAGATGTATGAAGGCTTGTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-672s1c1
Sequence:CCGGCTTGCCAACAAGAGGTTACCACTCGAGTGGTAACCTCTTGTTGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016167
VALIDATED
NOL7 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 7, 27kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-519s1c1
Sequence:CCGGGTACAGTCTGTCAGCCAGAATCTCGAGATTCTGGCTGACAGACTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-390s1c1
Sequence:CCGGGAGAAGTTAACCACAGCTTCACTCGAGTGAAGCTGTGGTTAACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-573s1c1
Sequence:CCGGGATCTGAGAGATTCAAGGCAACTCGAGTTGCCTTGAATCTCTCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-640s1c1
Sequence:CCGGCCAACAGGACTACTGTAAATACTCGAGTATTTACAGTAGTCCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-341s1c1
Sequence:CCGGGCTGTTCATCGAACAGAAGAACTCGAGTTCTTCTGTTCGATGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-401s1c1
Sequence:CCGGCACAGCTTCACAGACTAACATCTCGAGATGTTAGTCTGTGAAGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-431s1c1
Sequence:CCGGGCCAGGAAAGGTGAAAGAAGTCTCGAGACTTCTTTCACCTTTCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-545s1c1
Sequence:CCGGCTACTTGGCCGTAAGGCTAAACTCGAGTTTAGCCTTACGGCCAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-662s1c1
Sequence:CCGGGTTCCTGTCTCTTGCCAACAACTCGAGTTGTTGGCAAGAGACAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-597s1c1
Sequence:CCGGGCAGCACAAGCCTTCATACATCTCGAGATGTATGAAGGCTTGTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-672s1c1
Sequence:CCGGCTTGCCAACAAGAGGTTACCACTCGAGTGGTAACCTCTTGTTGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016167
VALIDATED
NOL7 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 7, 27kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-519s1c1
Sequence:CCGGGTACAGTCTGTCAGCCAGAATCTCGAGATTCTGGCTGACAGACTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-390s1c1
Sequence:CCGGGAGAAGTTAACCACAGCTTCACTCGAGTGAAGCTGTGGTTAACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-573s1c1
Sequence:CCGGGATCTGAGAGATTCAAGGCAACTCGAGTTGCCTTGAATCTCTCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-640s1c1
Sequence:CCGGCCAACAGGACTACTGTAAATACTCGAGTATTTACAGTAGTCCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-341s1c1
Sequence:CCGGGCTGTTCATCGAACAGAAGAACTCGAGTTCTTCTGTTCGATGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-401s1c1
Sequence:CCGGCACAGCTTCACAGACTAACATCTCGAGATGTTAGTCTGTGAAGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-431s1c1
Sequence:CCGGGCCAGGAAAGGTGAAAGAAGTCTCGAGACTTCTTTCACCTTTCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016167.3-545s1c1
Sequence:CCGGCTACTTGGCCGTAAGGCTAAACTCGAGTTTAGCCTTACGGCCAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-662s1c1
Sequence:CCGGGTTCCTGTCTCTTGCCAACAACTCGAGTTGTTGGCAAGAGACAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-597s1c1
Sequence:CCGGGCAGCACAAGCCTTCATACATCTCGAGATGTATGAAGGCTTGTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016167.3-672s1c1
Sequence:CCGGCTTGCCAACAAGAGGTTACCACTCGAGTGGTAACCTCTTGTTGGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)