EMAIL THIS PAGE TO A FRIEND

NOM1

nucleolar protein with MIF4G domain 1

36 Gene Product Result for
Synonyms: C7orf3 SGD1
UniProtKB ID: Q5C9Z4, Q96I08
Gene ID:
Human(64434) Summary: Proteins that contain MIF4G (middle of eIF4G (MIM 600495)) and/or MA3 domains, such as NOM1, function in protein translation. These domains include binding sites for members of the EIF4A family of ATP-dependent DEAD box RNA helicases (see EIF4A1; MIM 602641) (Simmons et al., 2005 [PubMed 15715967]
Mouse(433864) nucleolar protein with MIF4G domain 1
sheep(101118183) nucleolar protein with MIF4G domain 1
naked mole-rat(101718172) nucleolar protein with MIF4G domain 1
domestic guinea pig(100722898) nucleolar protein with MIF4G domain 1
Zebrafish(557585) nucleolar protein with MIF4G domain 1
cow(618228) nucleolar protein with MIF4G domain 1
domestic cat(101089180) nucleolar protein with MIF4G domain 1
dog(482820) nucleolar protein with MIF4G domain 1
chicken(420446) nucleolar protein with MIF4G domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_374590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374590 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138400 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138400 Rosetta Predictions human pricing
NM_001033457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089960 predicted 2308
2 SASI_Hs01_00089961 predicted 1355
3 SASI_Hs01_00089962 predicted 2394
4 SASI_Hs01_00089963 predicted 1551
5 SASI_Hs01_00089964 predicted 1643
6 SASI_Hs01_00089965 predicted 1586
7 SASI_Hs01_00089966 predicted 2295
8 SASI_Hs01_00089967 predicted 2189
9 SASI_Hs02_00363543 predicted 1354
10 SASI_Hs01_00089968 predicted 2317
11 SASI_Hs01_00089969 predicted 2143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197934 predicted 1391
2 SASI_Mm02_00288794 predicted 2658
3 SASI_Mm01_00197935 predicted 2063
4 SASI_Mm01_00197936 predicted 1240
5 SASI_Mm01_00197937 predicted 2046
6 SASI_Mm01_00197938 predicted 1715
7 SASI_Mm01_00197939 predicted 2275
8 SASI_Mm01_00197940 predicted 2136
9 SASI_Mm02_00288795 predicted 2646
10 SASI_Mm01_00197942 predicted 1027
11 SASI_Mm01_00197941 predicted 2290
12 SASI_Mm01_00197943 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374590
NOM1 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein with MIF4G domain 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-1687s1c1
Sequence:CCGGGCCAGCTACGAATTTCTCTAACTCGAGTTAGAGAAATTCGTAGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374590.2-2316s1c1
Sequence:CCGGGCTGGTGTGTATGATTGTCTTCTCGAGAAGACAATCATACACACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-1646s1c1
Sequence:CCGGCAGTTCAGCATATGGGACAAACTCGAGTTTGTCCCATATGCTGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-811s1c1
Sequence:CCGGGAAGTTCGATGCCATCTATAACTCGAGTTATAGATGGCATCGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374590.2-733s1c1
Sequence:CCGGGCATGTTCTCTTAGTCAGCATCTCGAGATGCTGACTAAGAGAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-847s1c1
Sequence:CCGGGAAAGAGTGTGACAACCTGTTCTCGAGAACAGGTTGTCACACTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374590
NOM1 MISSION shRNA shRNA Plasmid DNA
nucleolar protein with MIF4G domain 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-1687s1c1
Sequence:CCGGGCCAGCTACGAATTTCTCTAACTCGAGTTAGAGAAATTCGTAGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374590.2-2316s1c1
Sequence:CCGGGCTGGTGTGTATGATTGTCTTCTCGAGAAGACAATCATACACACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-1646s1c1
Sequence:CCGGCAGTTCAGCATATGGGACAAACTCGAGTTTGTCCCATATGCTGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-811s1c1
Sequence:CCGGGAAGTTCGATGCCATCTATAACTCGAGTTATAGATGGCATCGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374590.2-733s1c1
Sequence:CCGGGCATGTTCTCTTAGTCAGCATCTCGAGATGCTGACTAAGAGAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-847s1c1
Sequence:CCGGGAAAGAGTGTGACAACCTGTTCTCGAGAACAGGTTGTCACACTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374590
NOM1 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein with MIF4G domain 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-1687s1c1
Sequence:CCGGGCCAGCTACGAATTTCTCTAACTCGAGTTAGAGAAATTCGTAGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374590.2-2316s1c1
Sequence:CCGGGCTGGTGTGTATGATTGTCTTCTCGAGAAGACAATCATACACACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-1646s1c1
Sequence:CCGGCAGTTCAGCATATGGGACAAACTCGAGTTTGTCCCATATGCTGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-811s1c1
Sequence:CCGGGAAGTTCGATGCCATCTATAACTCGAGTTATAGATGGCATCGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374590.2-733s1c1
Sequence:CCGGGCATGTTCTCTTAGTCAGCATCTCGAGATGCTGACTAAGAGAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374590.2-847s1c1
Sequence:CCGGGAAAGAGTGTGACAACCTGTTCTCGAGAACAGGTTGTCACACTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033457
NOM1 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein with MIF4G domain 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033457.2-2778s21c1
Sequence:CCGGGAGAGGGTTGGGACCATAAATCTCGAGATTTATGGTCCCAACCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033457.2-1951s21c1
Sequence:CCGGCTGATGTCAGGAGGATCATATCTCGAGATATGATCCTCCTGACATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033457.2-1616s21c1
Sequence:CCGGCCAGAACAGGGTACGGTTTATCTCGAGATAAACCGTACCCTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033457.2-1333s21c1
Sequence:CCGGAGAAGTTTGATGCTATCTATACTCGAGTATAGATAGCATCAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033457
NOM1 MISSION shRNA shRNA Plasmid DNA
nucleolar protein with MIF4G domain 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033457.2-2778s21c1
Sequence:CCGGGAGAGGGTTGGGACCATAAATCTCGAGATTTATGGTCCCAACCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033457.2-1951s21c1
Sequence:CCGGCTGATGTCAGGAGGATCATATCTCGAGATATGATCCTCCTGACATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033457.2-1616s21c1
Sequence:CCGGCCAGAACAGGGTACGGTTTATCTCGAGATAAACCGTACCCTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033457.2-1333s21c1
Sequence:CCGGAGAAGTTTGATGCTATCTATACTCGAGTATAGATAGCATCAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033457
NOM1 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein with MIF4G domain 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033457.2-2778s21c1
Sequence:CCGGGAGAGGGTTGGGACCATAAATCTCGAGATTTATGGTCCCAACCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033457.2-1951s21c1
Sequence:CCGGCTGATGTCAGGAGGATCATATCTCGAGATATGATCCTCCTGACATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033457.2-1616s21c1
Sequence:CCGGCCAGAACAGGGTACGGTTTATCTCGAGATAAACCGTACCCTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033457.2-1333s21c1
Sequence:CCGGAGAAGTTTGATGCTATCTATACTCGAGTATAGATAGCATCAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138400
VALIDATED
NOM1 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein with MIF4G domain 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138400.1-982s21c1
Sequence:CCGGGACGGTGACATAACGGATAAGCTCGAGCTTATCCGTTATGTCACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_138400.1-1413s21c1
Sequence:CCGGCACCGTCATTGCCCATTTATACTCGAGTATAAATGGGCAATGACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138400.1-652s21c1
Sequence:CCGGCGCGACGGTCTTGACTATATTCTCGAGAATATAGTCAAGACCGTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138400.1-3221s21c1
Sequence:CCGGACTAGAGGGTGCAGTTATAAACTCGAGTTTATAACTGCACCCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_138400.1-1638s21c1
Sequence:CCGGCCAGACCAGGATTCGGTTTATCTCGAGATAAACCGAATCCTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138400
VALIDATED
NOM1 MISSION shRNA shRNA Plasmid DNA
nucleolar protein with MIF4G domain 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138400.1-982s21c1
Sequence:CCGGGACGGTGACATAACGGATAAGCTCGAGCTTATCCGTTATGTCACCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_138400.1-1413s21c1
Sequence:CCGGCACCGTCATTGCCCATTTATACTCGAGTATAAATGGGCAATGACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138400.1-652s21c1
Sequence:CCGGCGCGACGGTCTTGACTATATTCTCGAGAATATAGTCAAGACCGTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138400.1-3221s21c1
Sequence:CCGGACTAGAGGGTGCAGTTATAAACTCGAGTTTATAACTGCACCCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_138400.1-1638s21c1
Sequence:CCGGCCAGACCAGGATTCGGTTTATCTCGAGATAAACCGAATCCTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138400
VALIDATED
NOM1 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein with MIF4G domain 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_138400.1-982s21c1
Sequence:CCGGGACGGTGACATAACGGATAAGCTCGAGCTTATCCGTTATGTCACCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_138400.1-1413s21c1
Sequence:CCGGCACCGTCATTGCCCATTTATACTCGAGTATAAATGGGCAATGACGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138400.1-652s21c1
Sequence:CCGGCGCGACGGTCTTGACTATATTCTCGAGAATATAGTCAAGACCGTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138400.1-3221s21c1
Sequence:CCGGACTAGAGGGTGCAGTTATAAACTCGAGTTTATAACTGCACCCTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_138400.1-1638s21c1
Sequence:CCGGCCAGACCAGGATTCGGTTTATCTCGAGATAAACCGAATCCTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)