EMAIL THIS PAGE TO A FRIEND

NONO

non-POU domain containing, octamer-binding

131 Gene Product Result for
Synonyms: NMT55 NRB54 P54 P54NRB
Gene ID:
Human(4841) Summary: This gene encodes an RNA-binding protein which plays various roles in the nucleus, including transcriptional regulation and RNA splicing. A rearrangement between this gene and the transcription factor E3 gene has been observed in papillary renal cell carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes exist on Chromosomes 2 and 16. [provided by RefSeq, Feb 2009]
Mouse(53610) non-POU-domain-containing, octamer binding protein
Rat(317259) non-POU domain containing, octamer-binding
Zebrafish(321994) non-POU domain containing, octamer-binding
chicken(428701) non-POU domain containing, octamer-binding
domestic cat(101092666) non-POU domain containing, octamer-binding
cow(615175) non-POU domain containing, octamer-binding
Horse(100056029) non-POU domain containing, octamer-binding
dog(612773) non-POU domain containing, octamer-binding
naked mole-rat(101719151) non-POU domain containing, octamer-binding
domestic guinea pig(100729646) non-POU domain containing, octamer-binding
sheep(101105886) non-POU domain containing, octamer-binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105082 Anti-NONO (6-20) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2108534 Anti-NONO (AB1) IgG fraction of antiserum rat, horse, canine, rat, guinea pig, bovine, human
immunofluorescence, western blot pricing
AV40715 Anti-NONO (AB1) antibody produced in rabbit IgG fraction of antiserum guinea pig, horse, bovine, human, mouse, canine, rat
western blot pricing
SAB2108535 Anti-NONO (AB2) IgG fraction of antiserum human, rat, rabbit, bovine, guinea pig, horse, mouse, bovine
immunofluorescence, immunohistochemistry, western blot pricing
AV40716 Anti-NONO (AB2) antibody produced in rabbit IgG fraction of antiserum horse, human, bovine, rat, guinea pig, rabbit, mouse, canine
immunohistochemistry, western blot pricing
N8664 Anti-NONO (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
N8789 Anti-NONO (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
HPA054094 Anti-NONO antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA054559 Anti-NONO antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2500701 Anti-NONO/P54NRB antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, mouse, canine
ELISA, immunohistochemistry, western blot pricing
SAB4200502 Monoclonal Anti-NONO antibody produced in mouse ~1.0 mg/mL, clone NC5, purified immunoglobulin mouse, rat
immunofluorescence, western blot pricing
PLA0119 Rabbit anti-NONO Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, guinea pig, rabbit, human, rat, pig, rat, mouse, horse, rhesus monkey, bovine, primate
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007363 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007363 Rosetta Predictions human pricing
NM_001012356 Rosetta Predictions rat pricing
NM_023144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343477 predicted 1561
2 SASI_Hs02_00343478 predicted 1059
3 SASI_Hs02_00343479 predicted 629
4 SASI_Hs02_00343480 predicted 497
5 SASI_Hs02_00343481 predicted 482
6 SASI_Hs02_00343482 predicted 545
7 SASI_Hs02_00343483 predicted 1334
8 SASI_Hs02_00343484 predicted 617
9 SASI_Hs02_00343485 predicted 667
10 SASI_Hs02_00343486 predicted 706
11 SASI_Hs01_00246530 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200541 predicted 1512
2 SASI_Rn01_00067140 predicted 1608
3 SASI_Rn01_00067141 predicted 1553
4 SASI_Rn02_00200542 predicted 453
5 SASI_Rn02_00200543 predicted 1382
6 SASI_Rn02_00200544 predicted 820
7 SASI_Rn01_00067143 predicted 1614
8 SASI_Rn02_00200545 predicted 953
9 SASI_Rn01_00067145 predicted 1142
10 SASI_Rn02_00200546 predicted 1073
11 SASI_Rn01_00067142 predicted 1021
12 SASI_Rn01_00067144 predicted 917
13 SASI_Rn01_00067146 predicted 871
14 SASI_Rn01_00067147 predicted 288
15 SASI_Rn01_00067148 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076441 predicted 493
2 SASI_Mm01_00076443 predicted 1536
3 SASI_Mm01_00076444 predicted 1527
4 SASI_Mm01_00076445 predicted 1035
5 SASI_Mm01_00076446 predicted 1300
6 SASI_Mm01_00076447 predicted 1545
7 SASI_Mm01_00076448 predicted 1074
8 SASI_Mm01_00076449 predicted 1270
9 SASI_Mm01_00076450 predicted 597
10 SASI_Mm02_00326873 predicted 806
11 SASI_Mm01_00076442 predicted 1563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007363
VALIDATED
NONO MISSION shRNA Bacterial Glycerol Stock
non-POU domain containing, octamer-binding
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-1644s1c1
Sequence:CCGGGCCAGAATTCTACCCTGGAAACTCGAGTTTCCAGGGTAGAATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-1483s1c1
Sequence:CCGGGCTGCTACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007363.3-637s1c1
Sequence:CCGGCCTCAGTATGTGTCCAACGAACTCGAGTTCGTTGGACACATACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-470s1c1
Sequence:CCGGCAGGCGAAGTCTTCATTCATACTCGAGTATGAATGAAGACTTCGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-469s1c1
Sequence:CCGGGCAGGCGAAGTCTTCATTCATCTCGAGATGAATGAAGACTTCGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-1511s21c1
Sequence:CCGGTGAGCACCAGGTCATGCTAATCTCGAGATTAGCATGACCTGGTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-1304s21c1
Sequence:CCGGTCCAGAGAAGCTGGTTATAAACTCGAGTTTATAACCAGCTTCTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-2069s21c1
Sequence:CCGGGCCAGAATTCTACCCTGGAAACTCGAGTTTCCAGGGTAGAATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-895s21c1
Sequence:CCGGCAGGCGAAGTCTTCATTCATACTCGAGTATGAATGAAGACTTCGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-1908s21c1
Sequence:CCGGGCTGCTACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007363
VALIDATED
NONO MISSION shRNA shRNA Plasmid DNA
non-POU domain containing, octamer-binding
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-1644s1c1
Sequence:CCGGGCCAGAATTCTACCCTGGAAACTCGAGTTTCCAGGGTAGAATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-1483s1c1
Sequence:CCGGGCTGCTACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007363.3-637s1c1
Sequence:CCGGCCTCAGTATGTGTCCAACGAACTCGAGTTCGTTGGACACATACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-470s1c1
Sequence:CCGGCAGGCGAAGTCTTCATTCATACTCGAGTATGAATGAAGACTTCGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-469s1c1
Sequence:CCGGGCAGGCGAAGTCTTCATTCATCTCGAGATGAATGAAGACTTCGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-1511s21c1
Sequence:CCGGTGAGCACCAGGTCATGCTAATCTCGAGATTAGCATGACCTGGTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-1304s21c1
Sequence:CCGGTCCAGAGAAGCTGGTTATAAACTCGAGTTTATAACCAGCTTCTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-2069s21c1
Sequence:CCGGGCCAGAATTCTACCCTGGAAACTCGAGTTTCCAGGGTAGAATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-895s21c1
Sequence:CCGGCAGGCGAAGTCTTCATTCATACTCGAGTATGAATGAAGACTTCGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-1908s21c1
Sequence:CCGGGCTGCTACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007363
VALIDATED
NONO MISSION shRNA Lentiviral Transduction Particles
non-POU domain containing, octamer-binding
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-1644s1c1
Sequence:CCGGGCCAGAATTCTACCCTGGAAACTCGAGTTTCCAGGGTAGAATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-1483s1c1
Sequence:CCGGGCTGCTACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007363.3-637s1c1
Sequence:CCGGCCTCAGTATGTGTCCAACGAACTCGAGTTCGTTGGACACATACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-470s1c1
Sequence:CCGGCAGGCGAAGTCTTCATTCATACTCGAGTATGAATGAAGACTTCGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007363.3-469s1c1
Sequence:CCGGGCAGGCGAAGTCTTCATTCATCTCGAGATGAATGAAGACTTCGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-1511s21c1
Sequence:CCGGTGAGCACCAGGTCATGCTAATCTCGAGATTAGCATGACCTGGTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-1304s21c1
Sequence:CCGGTCCAGAGAAGCTGGTTATAAACTCGAGTTTATAACCAGCTTCTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-2069s21c1
Sequence:CCGGGCCAGAATTCTACCCTGGAAACTCGAGTTTCCAGGGTAGAATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-895s21c1
Sequence:CCGGCAGGCGAAGTCTTCATTCATACTCGAGTATGAATGAAGACTTCGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007363.4-1908s21c1
Sequence:CCGGGCTGCTACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023144
VALIDATED
NONO MISSION shRNA Bacterial Glycerol Stock
non-POU domain containing, octamer-binding
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023144.1-1418s1c1
Sequence:CCGGCCCACCAACAACTGAACGTTTCTCGAGAAACGTTCAGTTGTTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023144.1-283s1c1
Sequence:CCGGGCCAGAATGAAGGCTTGACTACTCGAGTAGTCAAGCCTTCATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023144.1-357s1c1
Sequence:CCGGCGTCTCTTTGTGGGCAATCTTCTCGAGAAGATTGCCCACAAAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023144.1-2034s1c1
Sequence:CCGGCGGTTGTGTTATATCTCATATCTCGAGATATGAGATATAACACAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023144.1-1446s1c1
Sequence:CCGGGCTGCAACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-486s21c1
Sequence:CCGGACACGAACCCTAGCGGAAATTCTCGAGAATTTCCGCTAGGGTTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-1049s21c1
Sequence:CCGGTGAGCACCAGGTTATGCTAATCTCGAGATTAGCATAACCTGGTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-2034s21c1
Sequence:CCGGCGGTTGTGTTATATCTCATATCTCGAGATATGAGATATAACACAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023144.1-1446s21c1
Sequence:CCGGGCTGCAACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-283s21c1
Sequence:CCGGGCCAGAATGAAGGCTTGACTACTCGAGTAGTCAAGCCTTCATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023144
VALIDATED
NONO MISSION shRNA shRNA Plasmid DNA
non-POU domain containing, octamer-binding
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023144.1-1418s1c1
Sequence:CCGGCCCACCAACAACTGAACGTTTCTCGAGAAACGTTCAGTTGTTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023144.1-283s1c1
Sequence:CCGGGCCAGAATGAAGGCTTGACTACTCGAGTAGTCAAGCCTTCATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023144.1-357s1c1
Sequence:CCGGCGTCTCTTTGTGGGCAATCTTCTCGAGAAGATTGCCCACAAAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023144.1-2034s1c1
Sequence:CCGGCGGTTGTGTTATATCTCATATCTCGAGATATGAGATATAACACAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023144.1-1446s1c1
Sequence:CCGGGCTGCAACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-486s21c1
Sequence:CCGGACACGAACCCTAGCGGAAATTCTCGAGAATTTCCGCTAGGGTTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-1049s21c1
Sequence:CCGGTGAGCACCAGGTTATGCTAATCTCGAGATTAGCATAACCTGGTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-2034s21c1
Sequence:CCGGCGGTTGTGTTATATCTCATATCTCGAGATATGAGATATAACACAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023144.1-1446s21c1
Sequence:CCGGGCTGCAACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-283s21c1
Sequence:CCGGGCCAGAATGAAGGCTTGACTACTCGAGTAGTCAAGCCTTCATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023144
VALIDATED
NONO MISSION shRNA Lentiviral Transduction Particles
non-POU domain containing, octamer-binding
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023144.1-1418s1c1
Sequence:CCGGCCCACCAACAACTGAACGTTTCTCGAGAAACGTTCAGTTGTTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023144.1-283s1c1
Sequence:CCGGGCCAGAATGAAGGCTTGACTACTCGAGTAGTCAAGCCTTCATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023144.1-357s1c1
Sequence:CCGGCGTCTCTTTGTGGGCAATCTTCTCGAGAAGATTGCCCACAAAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023144.1-2034s1c1
Sequence:CCGGCGGTTGTGTTATATCTCATATCTCGAGATATGAGATATAACACAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023144.1-1446s1c1
Sequence:CCGGGCTGCAACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-486s21c1
Sequence:CCGGACACGAACCCTAGCGGAAATTCTCGAGAATTTCCGCTAGGGTTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-1049s21c1
Sequence:CCGGTGAGCACCAGGTTATGCTAATCTCGAGATTAGCATAACCTGGTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-2034s21c1
Sequence:CCGGCGGTTGTGTTATATCTCATATCTCGAGATATGAGATATAACACAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023144.1-1446s21c1
Sequence:CCGGGCTGCAACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023144.1-283s21c1
Sequence:CCGGGCCAGAATGAAGGCTTGACTACTCGAGTAGTCAAGCCTTCATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)