EMAIL THIS PAGE TO A FRIEND

NOP10

NOP10 ribonucleoprotein

44 Gene Product Result for
Synonyms: DKCB1 NOLA3 NOP10P
UniProtKB ID: Q9NPE3
Gene ID:
Human(55505) Summary: This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA2 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nop10p. [provided by RefSeq, Jul 2008]
Mouse(66181) NOP10 ribonucleoprotein
Rat(691534) NOP10 ribonucleoprotein
Thale Cress(816569) nucleolar RNA binding protein NOP10
cow(616675) NOP10 ribonucleoprotein homolog (yeast)
domestic cat(101098467) NOP10 ribonucleoprotein homolog (yeast)
dog(607299) NOP10 ribonucleoprotein homolog (yeast)
Zebrafish(445391) NOP10 ribonucleoprotein homolog (yeast)
domestic guinea pig(100728268) NOP10 ribonucleoprotein
naked mole-rat(101703459) NOP10 ribonucleoprotein
sheep(101122111) NOP10 ribonucleoprotein homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018648 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018648 Rosetta Predictions human pricing
NM_001126100 Rosetta Predictions rat pricing
NM_025403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214398 predicted 233
2 SASI_Hs01_00214399 predicted 211
3 SASI_Hs01_00214400 predicted 198
4 SASI_Hs01_00214401 predicted 212
5 SASI_Hs01_00214402 predicted 234
6 SASI_Hs01_00214403 predicted 206
7 SASI_Hs01_00214404 predicted 217
8 SASI_Hs01_00214405 predicted 204
9 SASI_Hs01_00214406 predicted 209
10 SASI_Hs01_00214407 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253013 predicted 216
2 SASI_Rn02_00253014 predicted 278
3 SASI_Rn02_00253015 predicted 557
4 SASI_Rn02_00253016 predicted 579
5 SASI_Rn02_00253017 predicted 404
6 SASI_Rn02_00253018 predicted 288
7 SASI_Rn02_00253019 predicted 451
8 SASI_Rn02_00253020 predicted 551
9 SASI_Rn02_00253021 predicted 242
10 SASI_Rn02_00253022 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105722 predicted 240
2 SASI_Mm01_00105723 predicted 180
3 SASI_Mm01_00105724 predicted 381
4 SASI_Mm02_00328157 predicted 269
5 SASI_Mm01_00105725 predicted 297
6 SASI_Mm01_00105726 predicted 496
7 SASI_Mm01_00105727 predicted 540
8 SASI_Mm01_00105728 predicted 361
9 SASI_Mm01_00105729 predicted 100
10 SASI_Mm01_00105730 predicted 108
11 SASI_Mm01_00105731 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025403
VALIDATED
NOP10 MISSION shRNA Bacterial Glycerol Stock
NOP10 ribonucleoprotein
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-117s21c1
Sequence:CCGGACCCTATGGGACAACAGACTTCTCGAGAAGTCTGTTGTCCCATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025403.3-362s21c1
Sequence:CCGGACCACGTGAATGAGTCTATACCTCGAGGTATAGACTCATTCACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-58s21c1
Sequence:CCGGGTTTCTCCAATATTACCTCAACTCGAGTTGAGGTAATATTGGAGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-172s21c1
Sequence:CCGGCAAATATTCAAGACACCGAATCTCGAGATTCGGTGTCTTGAATATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-81s21c1
Sequence:CCGGAGCAGGGCGATCGCGTTTATACTCGAGTATAAACGCGATCGCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-242s21c1
Sequence:CCGGGTCCTCTGAGGGCTCGTTAATCTCGAGATTAACGAGCCCTCAGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-194s21c1
Sequence:CCGGACCATCAAGAAACGCTTCAAGCTCGAGCTTGAAGCGTTTCTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025403.3-273s21c1
Sequence:CCGGGCTCATGCCTCGGCCTATTATCTCGAGATAATAGGCCGAGGCATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025403.1-172s1c1
Sequence:CCGGCAAATATTCAAGACACCGAATCTCGAGATTCGGTGTCTTGAATATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025403.1-88s1c1
Sequence:CCGGCGATCGCGTTTATACGCTGAACTCGAGTTCAGCGTATAAACGCGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025403.1-547s1c1
Sequence:CCGGGCCCTCATTGTAGCAATAGAACTCGAGTTCTATTGCTACAATGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025403.1-196s1c1
Sequence:CCGGCATCAAGAAACGCTTCAAGGTCTCGAGACCTTGAAGCGTTTCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025403.1-92s1c1
Sequence:CCGGCGCGTTTATACGCTGAAGAAACTCGAGTTTCTTCAGCGTATAAACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025403
VALIDATED
NOP10 MISSION shRNA shRNA Plasmid DNA
NOP10 ribonucleoprotein
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-117s21c1
Sequence:CCGGACCCTATGGGACAACAGACTTCTCGAGAAGTCTGTTGTCCCATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025403.3-362s21c1
Sequence:CCGGACCACGTGAATGAGTCTATACCTCGAGGTATAGACTCATTCACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-58s21c1
Sequence:CCGGGTTTCTCCAATATTACCTCAACTCGAGTTGAGGTAATATTGGAGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-172s21c1
Sequence:CCGGCAAATATTCAAGACACCGAATCTCGAGATTCGGTGTCTTGAATATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-81s21c1
Sequence:CCGGAGCAGGGCGATCGCGTTTATACTCGAGTATAAACGCGATCGCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-242s21c1
Sequence:CCGGGTCCTCTGAGGGCTCGTTAATCTCGAGATTAACGAGCCCTCAGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-194s21c1
Sequence:CCGGACCATCAAGAAACGCTTCAAGCTCGAGCTTGAAGCGTTTCTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025403.3-273s21c1
Sequence:CCGGGCTCATGCCTCGGCCTATTATCTCGAGATAATAGGCCGAGGCATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025403.1-172s1c1
Sequence:CCGGCAAATATTCAAGACACCGAATCTCGAGATTCGGTGTCTTGAATATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025403.1-88s1c1
Sequence:CCGGCGATCGCGTTTATACGCTGAACTCGAGTTCAGCGTATAAACGCGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025403.1-547s1c1
Sequence:CCGGGCCCTCATTGTAGCAATAGAACTCGAGTTCTATTGCTACAATGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025403.1-196s1c1
Sequence:CCGGCATCAAGAAACGCTTCAAGGTCTCGAGACCTTGAAGCGTTTCTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025403.1-92s1c1
Sequence:CCGGCGCGTTTATACGCTGAAGAAACTCGAGTTTCTTCAGCGTATAAACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025403
VALIDATED
NOP10 MISSION shRNA Lentiviral Transduction Particles
NOP10 ribonucleoprotein
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-117s21c1
Sequence:CCGGACCCTATGGGACAACAGACTTCTCGAGAAGTCTGTTGTCCCATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025403.3-362s21c1
Sequence:CCGGACCACGTGAATGAGTCTATACCTCGAGGTATAGACTCATTCACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-58s21c1
Sequence:CCGGGTTTCTCCAATATTACCTCAACTCGAGTTGAGGTAATATTGGAGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-172s21c1
Sequence:CCGGCAAATATTCAAGACACCGAATCTCGAGATTCGGTGTCTTGAATATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-81s21c1
Sequence:CCGGAGCAGGGCGATCGCGTTTATACTCGAGTATAAACGCGATCGCCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-242s21c1
Sequence:CCGGGTCCTCTGAGGGCTCGTTAATCTCGAGATTAACGAGCCCTCAGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025403.3-194s21c1
Sequence:CCGGACCATCAAGAAACGCTTCAAGCTCGAGCTTGAAGCGTTTCTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025403.3-273s21c1
Sequence:CCGGGCTCATGCCTCGGCCTATTATCTCGAGATAATAGGCCGAGGCATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025403.1-172s1c1
Sequence:CCGGCAAATATTCAAGACACCGAATCTCGAGATTCGGTGTCTTGAATATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025403.1-88s1c1
Sequence:CCGGCGATCGCGTTTATACGCTGAACTCGAGTTCAGCGTATAAACGCGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025403.1-547s1c1
Sequence:CCGGGCCCTCATTGTAGCAATAGAACTCGAGTTCTATTGCTACAATGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025403.1-196s1c1
Sequence:CCGGCATCAAGAAACGCTTCAAGGTCTCGAGACCTTGAAGCGTTTCTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025403.1-92s1c1
Sequence:CCGGCGCGTTTATACGCTGAAGAAACTCGAGTTTCTTCAGCGTATAAACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018648
VALIDATED
NOP10 MISSION shRNA Bacterial Glycerol Stock
NOP10 ribonucleoprotein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018648.2-145s1c1
Sequence:CCGGGCTGAAGAAATTTGACCCGATCTCGAGATCGGGTCAAATTTCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018648.2-144s1c1
Sequence:CCGGCGCTGAAGAAATTTGACCCGACTCGAGTCGGGTCAAATTTCTTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018648.2-344s1c1
Sequence:CCGGCGTAACCAAACTCTTCGGACTCTCGAGAGTCCGAAGAGTTTGGTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018648.2-205s1c1
Sequence:CCGGCCCAGATGACAAATACTCTCGCTCGAGCGAGAGTATTTGTCATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018648.2-129s1c1
Sequence:CCGGGAGATCGAGTCTATACGCTGACTCGAGTCAGCGTATAGACTCGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018648.2-244s1c1
Sequence:CCGGGAAACGCTTCAAGGTGCTCATCTCGAGATGAGCACCTTGAAGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018648.2-390s1c1
Sequence:CCGGCCATACTCTTTGGCATCCAGTCTCGAGACTGGATGCCAAAGAGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018648.3-235s21c1
Sequence:CCGGGAAACGCTTCAAGGTGCTCATCTCGAGATGAGCACCTTGAAGCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018648.3-136s21c1
Sequence:CCGGGCTGAAGAAATTTGACCCGATCTCGAGATCGGGTCAAATTTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018648.3-120s21c1
Sequence:CCGGGAGATCGAGTCTATACGCTGACTCGAGTCAGCGTATAGACTCGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018648.3-335s21c1
Sequence:CCGGCGTAACCAAACTCTTCGGACTCTCGAGAGTCCGAAGAGTTTGGTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018648
VALIDATED
NOP10 MISSION shRNA shRNA Plasmid DNA
NOP10 ribonucleoprotein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018648.2-145s1c1
Sequence:CCGGGCTGAAGAAATTTGACCCGATCTCGAGATCGGGTCAAATTTCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018648.2-144s1c1
Sequence:CCGGCGCTGAAGAAATTTGACCCGACTCGAGTCGGGTCAAATTTCTTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018648.2-344s1c1
Sequence:CCGGCGTAACCAAACTCTTCGGACTCTCGAGAGTCCGAAGAGTTTGGTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018648.2-205s1c1
Sequence:CCGGCCCAGATGACAAATACTCTCGCTCGAGCGAGAGTATTTGTCATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018648.2-129s1c1
Sequence:CCGGGAGATCGAGTCTATACGCTGACTCGAGTCAGCGTATAGACTCGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018648.2-244s1c1
Sequence:CCGGGAAACGCTTCAAGGTGCTCATCTCGAGATGAGCACCTTGAAGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018648.2-390s1c1
Sequence:CCGGCCATACTCTTTGGCATCCAGTCTCGAGACTGGATGCCAAAGAGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018648.3-235s21c1
Sequence:CCGGGAAACGCTTCAAGGTGCTCATCTCGAGATGAGCACCTTGAAGCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018648.3-136s21c1
Sequence:CCGGGCTGAAGAAATTTGACCCGATCTCGAGATCGGGTCAAATTTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018648.3-120s21c1
Sequence:CCGGGAGATCGAGTCTATACGCTGACTCGAGTCAGCGTATAGACTCGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018648.3-335s21c1
Sequence:CCGGCGTAACCAAACTCTTCGGACTCTCGAGAGTCCGAAGAGTTTGGTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018648
VALIDATED
NOP10 MISSION shRNA Lentiviral Transduction Particles
NOP10 ribonucleoprotein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018648.2-145s1c1
Sequence:CCGGGCTGAAGAAATTTGACCCGATCTCGAGATCGGGTCAAATTTCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018648.2-144s1c1
Sequence:CCGGCGCTGAAGAAATTTGACCCGACTCGAGTCGGGTCAAATTTCTTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018648.2-344s1c1
Sequence:CCGGCGTAACCAAACTCTTCGGACTCTCGAGAGTCCGAAGAGTTTGGTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018648.2-205s1c1
Sequence:CCGGCCCAGATGACAAATACTCTCGCTCGAGCGAGAGTATTTGTCATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018648.2-129s1c1
Sequence:CCGGGAGATCGAGTCTATACGCTGACTCGAGTCAGCGTATAGACTCGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018648.2-244s1c1
Sequence:CCGGGAAACGCTTCAAGGTGCTCATCTCGAGATGAGCACCTTGAAGCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018648.2-390s1c1
Sequence:CCGGCCATACTCTTTGGCATCCAGTCTCGAGACTGGATGCCAAAGAGTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018648.3-235s21c1
Sequence:CCGGGAAACGCTTCAAGGTGCTCATCTCGAGATGAGCACCTTGAAGCGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018648.3-136s21c1
Sequence:CCGGGCTGAAGAAATTTGACCCGATCTCGAGATCGGGTCAAATTTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018648.3-120s21c1
Sequence:CCGGGAGATCGAGTCTATACGCTGACTCGAGTCAGCGTATAGACTCGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018648.3-335s21c1
Sequence:CCGGCGTAACCAAACTCTTCGGACTCTCGAGAGTCCGAAGAGTTTGGTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)