EMAIL THIS PAGE TO A FRIEND

NOP14

NOP14 nucleolar protein

51 Gene Product Result for
Synonyms: C4orf9 NOL14 RES425 UTP2
UniProtKB ID: P78316, D3DVR6, Q7LGI5, Q7Z6K0, Q8TBR6
Gene ID:
Human(8602) Summary: NOP14 plays a role in the processing of the pre-18S rRNA and small ribosomal subunit assembly (Liu and Thiele, 2001 [PubMed 11694595]
Mouse(75416) NOP14 nucleolar protein
Rat(289724) NOP14 nucleolar protein
sheep(101122695) NOP14 nucleolar protein homolog (yeast)
naked mole-rat(101698213) NOP14 nucleolar protein
domestic guinea pig(100713601) NOP14 nucleolar protein
Zebrafish(321133) NOP14 nucleolar protein homolog (yeast)
chicken(422880) NOP14 nucleolar protein homolog (yeast)
dog(479076) NOP14 nucleolar protein homolog (yeast)
domestic cat(101098380) NOP14 nucleolar protein homolog (yeast)
cow(516995) NOP14 nucleolar protein homolog (yeast)
Horse(100051519) NOP14 nucleolar protein homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003703 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003703 Rosetta Predictions human pricing
NM_001106013 Rosetta Predictions rat pricing
NM_029278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157271 predicted 1886
2 SASI_Hs01_00157272 predicted 419
3 SASI_Hs01_00157273 predicted 468
4 SASI_Hs01_00157274 predicted 1558
5 SASI_Hs01_00157275 predicted 1875
6 SASI_Hs01_00157276 predicted 448
7 SASI_Hs01_00157277 predicted 701
8 SASI_Hs01_00157278 predicted 1670
9 SASI_Hs01_00157279 predicted 1368
10 SASI_Hs01_00157280 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214762 predicted 324
2 SASI_Rn02_00214763 predicted 1595
3 SASI_Rn02_00214764 predicted 291
4 SASI_Rn02_00214765 predicted 1650
5 SASI_Rn02_00214766 predicted 358
6 SASI_Rn02_00214767 predicted 1891
7 SASI_Rn02_00214768 predicted 1399
8 SASI_Rn02_00214769 predicted 1708
9 SASI_Rn02_00214770 predicted 314
10 SASI_Rn02_00214771 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148168 predicted 663
2 SASI_Mm01_00148169 predicted 2115
3 SASI_Mm01_00148170 predicted 471
4 SASI_Mm02_00335055 predicted 1136
5 SASI_Mm02_00335056 predicted 1657
6 SASI_Mm01_00148172 predicted 556
7 SASI_Mm01_00148173 predicted 2438
8 SASI_Mm02_00335057 predicted 1647
9 SASI_Mm01_00148176 predicted 1488
10 SASI_Mm02_00335058 predicted 2069
11 SASI_Mm01_00148171 predicted 1586
12 SASI_Mm01_00148174 predicted 1551
13 SASI_Mm01_00148175 predicted 1527
14 SASI_Mm01_00148177 predicted 1576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003703
VALIDATED
NOP14 MISSION shRNA Bacterial Glycerol Stock
NOP14 nucleolar protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-2706s1c1
Sequence:CCGGCGTCACCTGATGAAATAGAATCTCGAGATTCTATTTCATCAGGTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-1545s1c1
Sequence:CCGGCCTCACAGTCATTGATAAGTTCTCGAGAACTTATCAATGACTGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-261s1c1
Sequence:CCGGCAGGAAGCGTACACAGACTTTCTCGAGAAAGTCTGTGTACGCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-2752s1c1
Sequence:CCGGCGGGAATGGTCTGTGTGTTATCTCGAGATAACACACAGACCATTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003703.1-1734s1c1
Sequence:CCGGGCTATTTCCAACTTCCGACTTCTCGAGAAGTCGGAAGTTGGAAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003703
VALIDATED
NOP14 MISSION shRNA shRNA Plasmid DNA
NOP14 nucleolar protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-2706s1c1
Sequence:CCGGCGTCACCTGATGAAATAGAATCTCGAGATTCTATTTCATCAGGTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-1545s1c1
Sequence:CCGGCCTCACAGTCATTGATAAGTTCTCGAGAACTTATCAATGACTGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-261s1c1
Sequence:CCGGCAGGAAGCGTACACAGACTTTCTCGAGAAAGTCTGTGTACGCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-2752s1c1
Sequence:CCGGCGGGAATGGTCTGTGTGTTATCTCGAGATAACACACAGACCATTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003703.1-1734s1c1
Sequence:CCGGGCTATTTCCAACTTCCGACTTCTCGAGAAGTCGGAAGTTGGAAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003703
VALIDATED
NOP14 MISSION shRNA Lentiviral Transduction Particles
NOP14 nucleolar protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-2706s1c1
Sequence:CCGGCGTCACCTGATGAAATAGAATCTCGAGATTCTATTTCATCAGGTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-1545s1c1
Sequence:CCGGCCTCACAGTCATTGATAAGTTCTCGAGAACTTATCAATGACTGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-261s1c1
Sequence:CCGGCAGGAAGCGTACACAGACTTTCTCGAGAAAGTCTGTGTACGCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003703.1-2752s1c1
Sequence:CCGGCGGGAATGGTCTGTGTGTTATCTCGAGATAACACACAGACCATTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003703.1-1734s1c1
Sequence:CCGGGCTATTTCCAACTTCCGACTTCTCGAGAAGTCGGAAGTTGGAAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029278
VALIDATED
NOP14 MISSION shRNA Bacterial Glycerol Stock
NOP14 nucleolar protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029278.1-219s1c1
Sequence:CCGGGAGAACCCAAACTTTACTAAACTCGAGTTTAGTAAAGTTTGGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029278.1-973s1c1
Sequence:CCGGGATGGCTTTATACTGGATAAACTCGAGTTTATCCAGTATAAAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029278.2-2493s21c1
Sequence:CCGGACAAACACAAGCGGGAATTTACTCGAGTAAATTCCCGCTTGTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-309s21c1
Sequence:CCGGCTTTACTAAAGGAGTACAAAGCTCGAGCTTTGTACTCCTTTAGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-1029s21c1
Sequence:CCGGATACATCAGCAGATGATTTAACTCGAGTTAAATCATCTGCTGATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-1582s21c1
Sequence:CCGGAGACCTCAAGACCATCGATAACTCGAGTTATCGATGGTCTTGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029278.2-1649s1c1
Sequence:CCGGGCAAGTGACTCCATAAGATTTCTCGAGAAATCTTATGGAGTCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-1649s21c1
Sequence:CCGGGCAAGTGACTCCATAAGATTTCTCGAGAAATCTTATGGAGTCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029278
VALIDATED
NOP14 MISSION shRNA shRNA Plasmid DNA
NOP14 nucleolar protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029278.1-219s1c1
Sequence:CCGGGAGAACCCAAACTTTACTAAACTCGAGTTTAGTAAAGTTTGGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029278.1-973s1c1
Sequence:CCGGGATGGCTTTATACTGGATAAACTCGAGTTTATCCAGTATAAAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029278.2-2493s21c1
Sequence:CCGGACAAACACAAGCGGGAATTTACTCGAGTAAATTCCCGCTTGTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-309s21c1
Sequence:CCGGCTTTACTAAAGGAGTACAAAGCTCGAGCTTTGTACTCCTTTAGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-1029s21c1
Sequence:CCGGATACATCAGCAGATGATTTAACTCGAGTTAAATCATCTGCTGATGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-1582s21c1
Sequence:CCGGAGACCTCAAGACCATCGATAACTCGAGTTATCGATGGTCTTGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029278.2-1649s1c1
Sequence:CCGGGCAAGTGACTCCATAAGATTTCTCGAGAAATCTTATGGAGTCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-1649s21c1
Sequence:CCGGGCAAGTGACTCCATAAGATTTCTCGAGAAATCTTATGGAGTCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029278
VALIDATED
NOP14 MISSION shRNA Lentiviral Transduction Particles
NOP14 nucleolar protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029278.1-219s1c1
Sequence:CCGGGAGAACCCAAACTTTACTAAACTCGAGTTTAGTAAAGTTTGGGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029278.1-973s1c1
Sequence:CCGGGATGGCTTTATACTGGATAAACTCGAGTTTATCCAGTATAAAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029278.2-2493s21c1
Sequence:CCGGACAAACACAAGCGGGAATTTACTCGAGTAAATTCCCGCTTGTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-309s21c1
Sequence:CCGGCTTTACTAAAGGAGTACAAAGCTCGAGCTTTGTACTCCTTTAGTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-1029s21c1
Sequence:CCGGATACATCAGCAGATGATTTAACTCGAGTTAAATCATCTGCTGATGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-1582s21c1
Sequence:CCGGAGACCTCAAGACCATCGATAACTCGAGTTATCGATGGTCTTGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029278.2-1649s1c1
Sequence:CCGGGCAAGTGACTCCATAAGATTTCTCGAGAAATCTTATGGAGTCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029278.2-1649s21c1
Sequence:CCGGGCAAGTGACTCCATAAGATTTCTCGAGAAATCTTATGGAGTCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)