EMAIL THIS PAGE TO A FRIEND

NOP16

NOP16 nucleolar protein

59 Gene Product Result for
Synonyms: HSPC111 HSPC185
UniProtKB ID: Q9Y3C1, B4DV13, D6RGD3, Q05D05, Q6IAI6, Q8IXL5
Gene ID:
Human(51491) Summary: NOP16 is transcriptionally regulated by c-Myc (MYC; MIM 190080), upregulated in breast cancer, and overexpression is associated with poor patient survival (Butt et al., 2008).[supplied by OMIM, Jun 2009]
Mouse(28126) NOP16 nucleolar protein
Rat(306768) NOP16 nucleolar protein
Zebrafish(436807) NOP16 nucleolar protein homolog (yeast)
chicken(416228) NOP16 nucleolar protein homolog (yeast)
cow(506421) NOP16 nucleolar protein homolog (yeast)
domestic cat(101082464) NOP16 nucleolar protein homolog (yeast)
dog(479282) nucleolar protein 16-like
domestic guinea pig(100731116) NOP16 nucleolar protein
naked mole-rat(101714216) NOP16 nucleolar protein
sheep(101116825) NOP16 nucleolar protein homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016391 Rosetta Predictions human pricing
NM_001047095 Rosetta Predictions rat pricing
NM_178605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349387 predicted 265
2 SASI_Hs02_00349388 predicted 262
3 SASI_Hs01_00241740 predicted 233
4 SASI_Hs02_00349389 predicted 246
5 SASI_Hs02_00349390 predicted 269
6 SASI_Hs02_00349391 predicted 253
7 SASI_Hs02_00349392 predicted 193
8 SASI_Hs02_00349393 predicted 257
9 SASI_Hs02_00349394 predicted 222
10 SASI_Hs02_00349395 predicted 250
11 SASI_Hs01_00241731 predicted 900
12 SASI_Hs01_00241732 predicted 502
13 SASI_Hs01_00241733 predicted 775
14 SASI_Hs01_00241734 predicted 510
15 SASI_Hs01_00241735 predicted 548
16 SASI_Hs01_00241736 predicted 483
17 SASI_Hs01_00241737 predicted 563
18 SASI_Hs01_00241738 predicted 909
19 SASI_Hs01_00241739 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205884 predicted 686
2 SASI_Rn02_00205885 predicted 745
3 SASI_Rn02_00205886 predicted 436
4 SASI_Rn02_00205887 predicted 430
5 SASI_Rn02_00205888 predicted 627
6 SASI_Rn02_00205889 predicted 564
7 SASI_Rn02_00205890 predicted 547
8 SASI_Rn02_00205891 predicted 618
9 SASI_Rn02_00205892 predicted 356
10 SASI_Rn02_00205893 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083735 predicted 545
2 SASI_Mm01_00083744 predicted 249
3 SASI_Mm01_00083736 predicted 553
4 SASI_Mm01_00083737 predicted 205
5 SASI_Mm01_00083738 predicted 456
6 SASI_Mm01_00083739 predicted 197
7 SASI_Mm01_00083740 predicted 223
8 SASI_Mm01_00083741 predicted 372
9 SASI_Mm01_00083742 predicted 448
10 SASI_Mm02_00348946 predicted 239
11 SASI_Mm01_00083743 predicted 548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016391
VALIDATED
NOP16 MISSION shRNA Bacterial Glycerol Stock
NOP16 nucleolar protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-33s21c1
Sequence:CCGGGAAGTTTGGTTACAGTGTCAACTCGAGTTGACACTGTAACCAAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-259s21c1
Sequence:CCGGCTTGTACGGAAGCCCTATGTGCTCGAGCACATAGGGCTTCCGTACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-445s21c1
Sequence:CCGGCGGAGTAAGATCAACGTCTATCTCGAGATAGACGTTGATCTTACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016391.4-337s21c1
Sequence:CCGGCGGGACCTCATTGACTATGTACTCGAGTACATAGTCAATGAGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_016391.4-236s21c1
Sequence:CCGGACATAGAGGAGAGGCCTAAAGCTCGAGCTTTAGGCCTCTCCTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-122s21c1
Sequence:CCGGATGCCTGGGACCACGCTAAATCTCGAGATTTAGCGTGGTCCCAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-900s1c1
Sequence:CCGGTCGGAGTAAGATCAACGTCTACTCGAGTAGACGTTGATCTTACTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-1103s1c1
Sequence:CCGGTCCCATGGAATCAGAAGGTTACTCGAGTAACCTTCTGATTCCATGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-901s1c1
Sequence:CCGGCGGAGTAAGATCAACGTCTATCTCGAGATAGACGTTGATCTTACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016391.2-489s1c1
Sequence:CCGGGAAGTTTGGTTACAGTGTCAACTCGAGTTGACACTGTAACCAAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-793s1c1
Sequence:CCGGCGGGACCTCATTGACTATGTACTCGAGTACATAGTCAATGAGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016391
VALIDATED
NOP16 MISSION shRNA shRNA Plasmid DNA
NOP16 nucleolar protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-33s21c1
Sequence:CCGGGAAGTTTGGTTACAGTGTCAACTCGAGTTGACACTGTAACCAAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-259s21c1
Sequence:CCGGCTTGTACGGAAGCCCTATGTGCTCGAGCACATAGGGCTTCCGTACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-445s21c1
Sequence:CCGGCGGAGTAAGATCAACGTCTATCTCGAGATAGACGTTGATCTTACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016391.4-337s21c1
Sequence:CCGGCGGGACCTCATTGACTATGTACTCGAGTACATAGTCAATGAGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_016391.4-236s21c1
Sequence:CCGGACATAGAGGAGAGGCCTAAAGCTCGAGCTTTAGGCCTCTCCTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-122s21c1
Sequence:CCGGATGCCTGGGACCACGCTAAATCTCGAGATTTAGCGTGGTCCCAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-900s1c1
Sequence:CCGGTCGGAGTAAGATCAACGTCTACTCGAGTAGACGTTGATCTTACTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-1103s1c1
Sequence:CCGGTCCCATGGAATCAGAAGGTTACTCGAGTAACCTTCTGATTCCATGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-901s1c1
Sequence:CCGGCGGAGTAAGATCAACGTCTATCTCGAGATAGACGTTGATCTTACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016391.2-489s1c1
Sequence:CCGGGAAGTTTGGTTACAGTGTCAACTCGAGTTGACACTGTAACCAAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-793s1c1
Sequence:CCGGCGGGACCTCATTGACTATGTACTCGAGTACATAGTCAATGAGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016391
VALIDATED
NOP16 MISSION shRNA Lentiviral Transduction Particles
NOP16 nucleolar protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-33s21c1
Sequence:CCGGGAAGTTTGGTTACAGTGTCAACTCGAGTTGACACTGTAACCAAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-259s21c1
Sequence:CCGGCTTGTACGGAAGCCCTATGTGCTCGAGCACATAGGGCTTCCGTACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-445s21c1
Sequence:CCGGCGGAGTAAGATCAACGTCTATCTCGAGATAGACGTTGATCTTACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016391.4-337s21c1
Sequence:CCGGCGGGACCTCATTGACTATGTACTCGAGTACATAGTCAATGAGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_016391.4-236s21c1
Sequence:CCGGACATAGAGGAGAGGCCTAAAGCTCGAGCTTTAGGCCTCTCCTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016391.4-122s21c1
Sequence:CCGGATGCCTGGGACCACGCTAAATCTCGAGATTTAGCGTGGTCCCAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-900s1c1
Sequence:CCGGTCGGAGTAAGATCAACGTCTACTCGAGTAGACGTTGATCTTACTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-1103s1c1
Sequence:CCGGTCCCATGGAATCAGAAGGTTACTCGAGTAACCTTCTGATTCCATGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-901s1c1
Sequence:CCGGCGGAGTAAGATCAACGTCTATCTCGAGATAGACGTTGATCTTACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016391.2-489s1c1
Sequence:CCGGGAAGTTTGGTTACAGTGTCAACTCGAGTTGACACTGTAACCAAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016391.2-793s1c1
Sequence:CCGGCGGGACCTCATTGACTATGTACTCGAGTACATAGTCAATGAGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178605
VALIDATED
NOP16 MISSION shRNA Bacterial Glycerol Stock
NOP16 nucleolar protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178605.4-547s21c1
Sequence:CCGGAGATCCGGAATAAGATCAATGCTCGAGCATTGATCTTATTCCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178605.4-373s21c1
Sequence:CCGGGGAAGCCCTATGTGGTAAATGCTCGAGCATTTACCACATAGGGCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178605.4-229s21c1
Sequence:CCGGATGCCTGGGACCACACCAAATCTCGAGATTTGGTGTGGTCCCAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178605.4-1244s21c1
Sequence:CCGGAGCGAGCGGAGATGGATTATCCTCGAGGATAATCCATCTCCGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178605.4-443s21c1
Sequence:CCGGTCGGGACCTCATCGACTATGTCTCGAGACATAGTCGATGAGGTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178605.2-553s1c1
Sequence:CCGGCGGAATAAGATCAATGTCTATCTCGAGATAGACATTGATCTTATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190964    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178605.2-913s1c1
Sequence:CCGGCCTCTCAAGTGCTGGGATTAACTCGAGTTAATCCCAGCACTTGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178605.2-147s1c1
Sequence:CCGGCGGTTACAACGTCAACCGAAACTCGAGTTTCGGTTGACGTTGTAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178605
VALIDATED
NOP16 MISSION shRNA shRNA Plasmid DNA
NOP16 nucleolar protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178605.4-547s21c1
Sequence:CCGGAGATCCGGAATAAGATCAATGCTCGAGCATTGATCTTATTCCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178605.4-373s21c1
Sequence:CCGGGGAAGCCCTATGTGGTAAATGCTCGAGCATTTACCACATAGGGCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178605.4-229s21c1
Sequence:CCGGATGCCTGGGACCACACCAAATCTCGAGATTTGGTGTGGTCCCAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178605.4-1244s21c1
Sequence:CCGGAGCGAGCGGAGATGGATTATCCTCGAGGATAATCCATCTCCGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178605.4-443s21c1
Sequence:CCGGTCGGGACCTCATCGACTATGTCTCGAGACATAGTCGATGAGGTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178605.2-553s1c1
Sequence:CCGGCGGAATAAGATCAATGTCTATCTCGAGATAGACATTGATCTTATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190964    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178605.2-913s1c1
Sequence:CCGGCCTCTCAAGTGCTGGGATTAACTCGAGTTAATCCCAGCACTTGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178605.2-147s1c1
Sequence:CCGGCGGTTACAACGTCAACCGAAACTCGAGTTTCGGTTGACGTTGTAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178605
VALIDATED
NOP16 MISSION shRNA Lentiviral Transduction Particles
NOP16 nucleolar protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178605.4-547s21c1
Sequence:CCGGAGATCCGGAATAAGATCAATGCTCGAGCATTGATCTTATTCCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178605.4-373s21c1
Sequence:CCGGGGAAGCCCTATGTGGTAAATGCTCGAGCATTTACCACATAGGGCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178605.4-229s21c1
Sequence:CCGGATGCCTGGGACCACACCAAATCTCGAGATTTGGTGTGGTCCCAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178605.4-1244s21c1
Sequence:CCGGAGCGAGCGGAGATGGATTATCCTCGAGGATAATCCATCTCCGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178605.4-443s21c1
Sequence:CCGGTCGGGACCTCATCGACTATGTCTCGAGACATAGTCGATGAGGTCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178605.2-553s1c1
Sequence:CCGGCGGAATAAGATCAATGTCTATCTCGAGATAGACATTGATCTTATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190964    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178605.2-913s1c1
Sequence:CCGGCCTCTCAAGTGCTGGGATTAACTCGAGTTAATCCCAGCACTTGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178605.2-147s1c1
Sequence:CCGGCGGTTACAACGTCAACCGAAACTCGAGTTTCGGTTGACGTTGTAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)