EMAIL THIS PAGE TO A FRIEND

NOP9

NOP9 nucleolar protein

49 Gene Product Result for
Synonyms: C14orf21
UniProtKB ID: Q86U38, Q8IVF0, Q8TBS6
Gene ID:
Mouse(67842) NOP9 nucleolar protein
Rat(290235) NOP9 nucleolar protein
dog(608429) NOP9 nucleolar protein homolog (yeast)
domestic cat(101083008) NOP9 nucleolar protein homolog (yeast)
domestic guinea pig(100720267) NOP9 nucleolar protein
naked mole-rat(101720521) NOP9 nucleolar protein
sheep(101119644) NOP9 nucleolar protein homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174913 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174913 Rosetta Predictions human pricing
NM_001106040 Rosetta Predictions rat pricing
NM_026403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133144 predicted 852
2 SASI_Hs01_00133145 predicted 779
3 SASI_Hs01_00133146 predicted 1404
4 SASI_Hs01_00133149 predicted 881
5 SASI_Hs02_00368823 predicted 867
6 SASI_Hs01_00133152 predicted 1698
7 SASI_Hs02_00368824 predicted 878
8 SASI_Hs01_00133153 predicted 304
9 SASI_Hs02_00368825 predicted 860
10 SASI_Hs02_00368826 predicted 1633
11 SASI_Hs01_00133147 predicted 898
12 SASI_Hs01_00133148 predicted 1516
13 SASI_Hs01_00133150 predicted 971
14 SASI_Hs01_00133151 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215032 predicted 879
2 SASI_Rn02_00215033 predicted 1474
3 SASI_Rn02_00215034 predicted 1520
4 SASI_Rn02_00215035 predicted 1104
5 SASI_Rn02_00215036 predicted 679
6 SASI_Rn02_00215037 predicted 319
7 SASI_Rn02_00215038 predicted 1418
8 SASI_Rn02_00215039 predicted 1618
9 SASI_Rn02_00215040 predicted 1159
10 SASI_Rn02_00215041 predicted 1974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330190 predicted 1576
2 SASI_Mm01_00167861 predicted 1961
3 SASI_Mm01_00167862 predicted 1529
4 SASI_Mm01_00167863 predicted 882
5 SASI_Mm01_00167865 predicted 994
6 SASI_Mm01_00167866 predicted 1920
7 SASI_Mm01_00167867 predicted 884
8 SASI_Mm01_00167868 predicted 2026
9 SASI_Mm01_00167869 predicted 877
10 SASI_Mm02_00330191 predicted 1080
11 SASI_Mm01_00167864 predicted 1710
12 SASI_Mm01_00167870 predicted 1469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174913
NOP9 MISSION shRNA Bacterial Glycerol Stock
NOP9 nucleolar protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-1088s21c1
Sequence:CCGGCAAGACTCCAGAGCCTCTTTGCTCGAGCAAAGAGGCTCTGGAGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1414s1c1
Sequence:CCGGGCTTATGAGGTGTACTATGGACTCGAGTCCATAGTACACCTCATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1392s1c1
Sequence:CCGGGCCTCTCTTTGCCACTTTGATCTCGAGATCAAAGTGGCAAAGAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-624s21c1
Sequence:CCGGCGCTGAGGTGTGTGATGATTTCTCGAGAAATCATCACACACCTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-411s21c1
Sequence:CCGGCAGTCCCTTGAAACCGCTTTGCTCGAGCAAAGCGGTTTCAAGGGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1017s1c1
Sequence:CCGGCCTACTGCTATTTCTCCGAGACTCGAGTCTCGGAGAAATAGCAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-307s1c1
Sequence:CCGGCGAGATCTGATGGTGCACAATCTCGAGATTGTGCACCATCAGATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1698s1c1
Sequence:CCGGGCAGAACCTAAAGGGACAATACTCGAGTATTGTCCCTTTAGGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-238s21c1
Sequence:CCGGCCGGAAGCTCTGGGATATTTCCTCGAGGAAATATCCCAGAGCTTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174913
NOP9 MISSION shRNA shRNA Plasmid DNA
NOP9 nucleolar protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-1088s21c1
Sequence:CCGGCAAGACTCCAGAGCCTCTTTGCTCGAGCAAAGAGGCTCTGGAGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1414s1c1
Sequence:CCGGGCTTATGAGGTGTACTATGGACTCGAGTCCATAGTACACCTCATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1392s1c1
Sequence:CCGGGCCTCTCTTTGCCACTTTGATCTCGAGATCAAAGTGGCAAAGAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-624s21c1
Sequence:CCGGCGCTGAGGTGTGTGATGATTTCTCGAGAAATCATCACACACCTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-411s21c1
Sequence:CCGGCAGTCCCTTGAAACCGCTTTGCTCGAGCAAAGCGGTTTCAAGGGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1017s1c1
Sequence:CCGGCCTACTGCTATTTCTCCGAGACTCGAGTCTCGGAGAAATAGCAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-307s1c1
Sequence:CCGGCGAGATCTGATGGTGCACAATCTCGAGATTGTGCACCATCAGATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1698s1c1
Sequence:CCGGGCAGAACCTAAAGGGACAATACTCGAGTATTGTCCCTTTAGGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-238s21c1
Sequence:CCGGCCGGAAGCTCTGGGATATTTCCTCGAGGAAATATCCCAGAGCTTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174913
NOP9 MISSION shRNA Lentiviral Transduction Particles
NOP9 nucleolar protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-1088s21c1
Sequence:CCGGCAAGACTCCAGAGCCTCTTTGCTCGAGCAAAGAGGCTCTGGAGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1414s1c1
Sequence:CCGGGCTTATGAGGTGTACTATGGACTCGAGTCCATAGTACACCTCATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1392s1c1
Sequence:CCGGGCCTCTCTTTGCCACTTTGATCTCGAGATCAAAGTGGCAAAGAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-624s21c1
Sequence:CCGGCGCTGAGGTGTGTGATGATTTCTCGAGAAATCATCACACACCTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-411s21c1
Sequence:CCGGCAGTCCCTTGAAACCGCTTTGCTCGAGCAAAGCGGTTTCAAGGGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1017s1c1
Sequence:CCGGCCTACTGCTATTTCTCCGAGACTCGAGTCTCGGAGAAATAGCAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-307s1c1
Sequence:CCGGCGAGATCTGATGGTGCACAATCTCGAGATTGTGCACCATCAGATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174913.1-1698s1c1
Sequence:CCGGGCAGAACCTAAAGGGACAATACTCGAGTATTGTCCCTTTAGGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174913.1-238s21c1
Sequence:CCGGCCGGAAGCTCTGGGATATTTCCTCGAGGAAATATCCCAGAGCTTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026403
VALIDATED
NOP9 MISSION shRNA Bacterial Glycerol Stock
NOP9 nucleolar protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026403.2-367s1c1
Sequence:CCGGGAACAGGACTGGTAGCGAAATCTCGAGATTTCGCTACCAGTCCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174486    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026403.2-2058s1c1
Sequence:CCGGCAGATGTAGTAACATGCACAACTCGAGTTGTGCATGTTACTACATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026403.2-2088s1c1
Sequence:CCGGCCTACTATTCCAGAGGGTAAACTCGAGTTTACCCTCTGGAATAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026403.3-1342s1c1
Sequence:CCGGCAGGTCTTGCAGCTGTTATTTCTCGAGAAATAACAGCTGCAAGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-2216s21c1
Sequence:CCGGTCCCAAGACATACTGGTAAAGCTCGAGCTTTACCAGTATGTCTTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-978s21c1
Sequence:CCGGCTGCGATGCAGTCATTGATTACTCGAGTAATCAATGACTGCATCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-387s21c1
Sequence:CCGGGAACAGGACTGGTAGCGAAATCTCGAGATTTCGCTACCAGTCCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-255s21c1
Sequence:CCGGCCCGGAGGCTCTTGGATATTTCTCGAGAAATATCCAAGAGCCTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-1106s21c1
Sequence:CCGGAGAGACTCCAGCGCCTCTATACTCGAGTATAGAGGCGCTGGAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026403
VALIDATED
NOP9 MISSION shRNA shRNA Plasmid DNA
NOP9 nucleolar protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026403.2-367s1c1
Sequence:CCGGGAACAGGACTGGTAGCGAAATCTCGAGATTTCGCTACCAGTCCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174486    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026403.2-2058s1c1
Sequence:CCGGCAGATGTAGTAACATGCACAACTCGAGTTGTGCATGTTACTACATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026403.2-2088s1c1
Sequence:CCGGCCTACTATTCCAGAGGGTAAACTCGAGTTTACCCTCTGGAATAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026403.3-1342s1c1
Sequence:CCGGCAGGTCTTGCAGCTGTTATTTCTCGAGAAATAACAGCTGCAAGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-2216s21c1
Sequence:CCGGTCCCAAGACATACTGGTAAAGCTCGAGCTTTACCAGTATGTCTTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-978s21c1
Sequence:CCGGCTGCGATGCAGTCATTGATTACTCGAGTAATCAATGACTGCATCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-387s21c1
Sequence:CCGGGAACAGGACTGGTAGCGAAATCTCGAGATTTCGCTACCAGTCCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-255s21c1
Sequence:CCGGCCCGGAGGCTCTTGGATATTTCTCGAGAAATATCCAAGAGCCTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-1106s21c1
Sequence:CCGGAGAGACTCCAGCGCCTCTATACTCGAGTATAGAGGCGCTGGAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026403
VALIDATED
NOP9 MISSION shRNA Lentiviral Transduction Particles
NOP9 nucleolar protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026403.2-367s1c1
Sequence:CCGGGAACAGGACTGGTAGCGAAATCTCGAGATTTCGCTACCAGTCCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174486    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026403.2-2058s1c1
Sequence:CCGGCAGATGTAGTAACATGCACAACTCGAGTTGTGCATGTTACTACATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026403.2-2088s1c1
Sequence:CCGGCCTACTATTCCAGAGGGTAAACTCGAGTTTACCCTCTGGAATAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026403.3-1342s1c1
Sequence:CCGGCAGGTCTTGCAGCTGTTATTTCTCGAGAAATAACAGCTGCAAGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-2216s21c1
Sequence:CCGGTCCCAAGACATACTGGTAAAGCTCGAGCTTTACCAGTATGTCTTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-978s21c1
Sequence:CCGGCTGCGATGCAGTCATTGATTACTCGAGTAATCAATGACTGCATCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-387s21c1
Sequence:CCGGGAACAGGACTGGTAGCGAAATCTCGAGATTTCGCTACCAGTCCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-255s21c1
Sequence:CCGGCCCGGAGGCTCTTGGATATTTCTCGAGAAATATCCAAGAGCCTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026403.3-1106s21c1
Sequence:CCGGAGAGACTCCAGCGCCTCTATACTCGAGTATAGAGGCGCTGGAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)