EMAIL THIS PAGE TO A FRIEND

NOS1

nitric oxide synthase 1 (neuronal)

101 Gene Product Result for
Synonyms: IHPS1 N-NOS NC-NOS NOS bNOS nNOS
UniProtKB ID: P29475, E9PH30, O75713
Gene ID:
Human(4842) Summary: The protein encoded by this gene belongs to the family of nitric oxide synthases, which synthesize nitric oxide from L-arginine. Nitric oxide is a reactive free radical, which acts as a biologic mediator in several processes, including neurotransmission, and antimicrobial and antitumoral activities. In the brain and peripheral nervous system, nitric oxide displays many properties of a neurotransmitter, and has been implicated in neurotoxicity associated with stroke and neurodegenerative diseases, neural regulation of smooth muscle, including peristalsis, and penile erection. This protein is ubiquitously expressed, with high level of expression in skeletal muscle. Multiple transcript variants that differ in the 5' UTR have been described for this gene but the full-length nature of these transcripts is not known. Additionally, alternatively spliced transcript variants encoding different isoforms (some testis-specific) have been found for this gene.[provided by RefSeq, Feb 2011]
Mouse(18125) nitric oxide synthase 1, neuronal
Rat(24598) nitric oxide synthase 1, neuronal
Zebrafish(60658) nitric oxide synthase 1 (neuronal)
domestic cat(101100342) nitric oxide synthase 1 (neuronal)
cow(536132) nitric oxide synthase 1 (neuronal)
Horse(100051079) nitric oxide synthase 1 (neuronal)
dog(477498) nitric oxide synthase 1 (neuronal)
chicken(427721) nitric oxide synthase 1 (neuronal)
naked mole-rat(101711993) nitric oxide synthase 1 (neuronal)
Domestic Rabbit(100009243) nitric oxide synthase 1 (neuronal)
domestic guinea pig(100729682) nitric oxide synthase 1 (neuronal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
N7280 Anti-Nitric Oxide Synthase, Brain (1409-1429) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat
western blot pricing
N7155 Anti-Nitric Oxide Synthase, Brain (251-270) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human
microarray, western blot pricing
N217 Anti-Nitric Oxide Synthase, Universal antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, bovine, pig, rat, mouse
immunohistochemistry, western blot pricing
SAB4502010 Anti-NNOS antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4300426 Anti-NOS1 (Ab-852) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence pricing
SAB2500702 Anti-NOS1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA058312 Anti-NOS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4503951 Anti-phospho-n-NOS (pSer852) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301472 Anti-phospho-n-NOS (pSer852) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
N2280 Monoclonal Anti-Nitric Oxide Synthase, Brain (1-181) antibody produced in mouse clone NOS-B1, ascites fluid human, goat, rat, pig
microarray, western blot pricing
N218 Monoclonal Anti-Nitric Oxide Synthase, Universal antibody produced in mouse clone NOS-3F7-B11-B5, ascites fluid rat, mouse, bovine
immunohistochemistry, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P0547 Pentamidine isethionate salt powder human pricing

Small Molecule - Cofactor

Product # Description Species Add to Cart
 
S154 Sepiapterin solid human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T7313 1-[2-(Trifluoromethyl)phenyl]imidazole human pricing
W4262 1400W dihydrochloride >98%, solid human pricing
O3636 1H-[1,2,4]Oxadiazolo[4,3-a]quinoxalin-1-one powder human pricing
A5879 2-(2-Aminoethyl)isothiourea dihydrobromide human pricing
A51807 2-Amino-4,6-dimethylpyridine 99% human pricing
A7009 Aminoguanidine hemisulfate salt ≥98% human pricing
P8765 Ammonium pyrrolidinedithiocarbamate ~99% human pricing
M5250 Melatonin powder, ≥98% (TLC) human pricing
D4268 NG,NG-Dimethylarginine dihydrochloride human pricing
P1061 Proadifen hydrochloride analytical standard, ≥95% human pricing
M5171 S-Methyl-L-thiocitrulline acetate salt ≥98% (TLC) human pricing
S2501 Spermidine trihydrochloride ≥98% (TLC) human pricing
D2926 Diphenyleneiodonium chloride ≥98% human, mouse pricing
T144 (±)-Thalidomide ≥98%, powder human, mouse, rat pricing
T151 (+)-Thalidomide ≥98% (HPLC), powder human, mouse, rat pricing
T150 (−)-Thalidomide >98%, solid human, mouse, rat pricing
M7033 NG-Methyl-L-arginine acetate salt ≥98% (TLC) human, mouse, rat pricing
N5501 Nω-Nitro-L-arginine ≥98% (TLC) human, mouse, rat pricing
88544 Thio-L-citrulline ≥98.0% human, mouse, rat pricing
B1378 2,6-Di-tert-butyl-4-methylphenol ≥99.0% (GC), powder human, rat pricing
34750 2,6-Di-tert-butyl-4-methylphenol purum, ≥99.0% (GC) human, rat pricing
03762 2,6-Di-tert-butyl-4-methylphenol tested according to Ph Eur human, rat pricing
123080 2-Amino-4-methylpyridine 99% human, rat pricing
47168 3,5-Di-tert-4-butylhydroxytoluene (BHT) analytical standard human, rat pricing
157635 7,7,8,8-Tetracyanoquinodimethane 98% human, rat pricing
N7778 7-Nitroindazole ≥98% human, rat pricing
W218405 Butylated hydroxytoluene ≥99%, FCC, FG human, rat pricing
N7126 4-Nitrocatechol Sigma Grade rat pricing
N15553 4-Nitrocatechol 97% rat pricing
261661 5-Methyl-2-nitroaniline 95% rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000620 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087051 MISSION® esiRNA esiRNA targeting mouse Nos1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000620 Rosetta Predictions human pricing
NM_052799 Rosetta Predictions rat pricing
XM_579549 Rosetta Predictions rat pricing
NM_008712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113337 predicted 3641
2 SASI_Hs02_00302955 predicted 1728
3 SASI_Hs01_00113339 predicted 2492
4 SASI_Hs01_00113341 predicted 864
5 SASI_Hs01_00113342 predicted 3711
6 SASI_Hs01_00113343 predicted 2618
7 SASI_Hs01_00113344 predicted 2468
8 SASI_Hs01_00113345 predicted 787
9 SASI_Hs01_00113346 predicted 4547
10 SASI_Hs02_00302956 predicted 2273
11 SASI_Hs01_00113338 predicted 3321
12 SASI_Hs01_00113340 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047014 predicted 535
2 SASI_Rn01_00047015 predicted 3842
3 SASI_Rn01_00047016 predicted 3103
4 SASI_Rn01_00047017 predicted 1188
5 SASI_Rn01_00047018 predicted 1872
6 SASI_Rn01_00047019 predicted 2747
7 SASI_Rn01_00047020 predicted 1993
8 SASI_Rn01_00047021 predicted 281
9 SASI_Rn01_00047022 predicted 887
10 SASI_Rn01_00047023 predicted 3070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127362 predicted 2009
2 SASI_Rn01_00127363 predicted 1497
3 SASI_Rn01_00127364 predicted 1994
4 SASI_Rn01_00127365 predicted 1498
5 SASI_Rn01_00127366 predicted 1463
6 SASI_Rn01_00127367 predicted 1476
7 SASI_Rn01_00127368 predicted 1511
8 SASI_Rn01_00127369 predicted 1460
9 SASI_Rn01_00127370 predicted 1361
10 SASI_Rn01_00127371 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184159 predicted 3603
2 SASI_Mm01_00184160 predicted 3745
3 SASI_Mm01_00184161 predicted 2844
4 SASI_Mm01_00184162 predicted 2953
5 SASI_Mm01_00184163 predicted 915
6 SASI_Mm01_00184164 predicted 2644
7 SASI_Mm02_00314549 predicted 318
8 SASI_Mm01_00184165 predicted 1184
9 SASI_Mm01_00184166 predicted 1165
10 SASI_Mm01_00184167 predicted 2712
11 SASI_Mm01_00184168 predicted 3944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000620
NOS1 MISSION shRNA Bacterial Glycerol Stock
nitric oxide synthase 1 (neuronal)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000620.2-1504s21c1
Sequence:CCGGTCGTCCTCAACAACCCATATTCTCGAGAATATGGGTTGTTGAGGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-740s1c1
Sequence:CCGGCGTCTCTTCAAGCGCAAAGTTCTCGAGAACTTTGCGCTTGAAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-4940s1c1
Sequence:CCGGGCCTTCATTGAAGAGAGCAAACTCGAGTTTGCTCTCTTCAATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-2005s1c1
Sequence:CCGGCCACGGGATGTTCAACTACATCTCGAGATGTAGTTGAACATCCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-3163s1c1
Sequence:CCGGCGGCTGTGCTTTGATGGAAATCTCGAGATTTCCATCAAAGCACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-3912s1c1
Sequence:CCGGCGGCTTTAGGTGTCATCAGTACTCGAGTACTGATGACACCTAAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000620.2-4553s21c1
Sequence:CCGGGCAATCCAAGATAGATCATATCTCGAGATATGATCTATCTTGGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000620
NOS1 MISSION shRNA shRNA Plasmid DNA
nitric oxide synthase 1 (neuronal)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000620.2-1504s21c1
Sequence:CCGGTCGTCCTCAACAACCCATATTCTCGAGAATATGGGTTGTTGAGGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-740s1c1
Sequence:CCGGCGTCTCTTCAAGCGCAAAGTTCTCGAGAACTTTGCGCTTGAAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-4940s1c1
Sequence:CCGGGCCTTCATTGAAGAGAGCAAACTCGAGTTTGCTCTCTTCAATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-2005s1c1
Sequence:CCGGCCACGGGATGTTCAACTACATCTCGAGATGTAGTTGAACATCCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-3163s1c1
Sequence:CCGGCGGCTGTGCTTTGATGGAAATCTCGAGATTTCCATCAAAGCACAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-3912s1c1
Sequence:CCGGCGGCTTTAGGTGTCATCAGTACTCGAGTACTGATGACACCTAAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000620.2-4553s21c1
Sequence:CCGGGCAATCCAAGATAGATCATATCTCGAGATATGATCTATCTTGGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000620
NOS1 MISSION shRNA Lentiviral Transduction Particles
nitric oxide synthase 1 (neuronal)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000620.2-1504s21c1
Sequence:CCGGTCGTCCTCAACAACCCATATTCTCGAGAATATGGGTTGTTGAGGACGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-740s1c1
Sequence:CCGGCGTCTCTTCAAGCGCAAAGTTCTCGAGAACTTTGCGCTTGAAGAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-4940s1c1
Sequence:CCGGGCCTTCATTGAAGAGAGCAAACTCGAGTTTGCTCTCTTCAATGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-2005s1c1
Sequence:CCGGCCACGGGATGTTCAACTACATCTCGAGATGTAGTTGAACATCCCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-3163s1c1
Sequence:CCGGCGGCTGTGCTTTGATGGAAATCTCGAGATTTCCATCAAAGCACAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000620.1-3912s1c1
Sequence:CCGGCGGCTTTAGGTGTCATCAGTACTCGAGTACTGATGACACCTAAAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000620.2-4553s21c1
Sequence:CCGGGCAATCCAAGATAGATCATATCTCGAGATATGATCTATCTTGGATTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008712
VALIDATED
NOS1 MISSION shRNA Bacterial Glycerol Stock
nitric oxide synthase 1 (neuronal)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-127s21c1
Sequence:CCGGAGATCCAACCCAACGTCATTTCTCGAGAAATGACGTTGGGTTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-3950s21c1
Sequence:CCGGACAATCCAAGATAGATCATATCTCGAGATATGATCTATCTTGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-3604s21c1
Sequence:CCGGTGCTACAACCTCGCTACTATTCTCGAGAATAGTAGCGAGGTTGTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008712.1-1983s1c1
Sequence:CCGGGCCCTGGTGGAGATTAACATTCTCGAGAATGTTAATCTCCACCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008712.1-1171s1c1
Sequence:CCGGCCAAAGAATTTCTCGACCAATCTCGAGATTGGTCGAGAAATTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008712.1-1880s1c1
Sequence:CCGGCGTTCGTGATTACTGTGACAACTCGAGTTGTCACAGTAATCACGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008712.1-1470s1c1
Sequence:CCGGGCCATCACTATATTCCCTCAACTCGAGTTGAGGGAATATAGTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-1462s21c1
Sequence:CCGGTCAGGTCGGCCATCACTATATCTCGAGATATAGTGATGGCCGACCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-4117s21c1
Sequence:CCGGAGGAGCAAGGAGGCCATATTTCTCGAGAAATATGGCCTCCTTGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008712
VALIDATED
NOS1 MISSION shRNA shRNA Plasmid DNA
nitric oxide synthase 1 (neuronal)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-127s21c1
Sequence:CCGGAGATCCAACCCAACGTCATTTCTCGAGAAATGACGTTGGGTTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-3950s21c1
Sequence:CCGGACAATCCAAGATAGATCATATCTCGAGATATGATCTATCTTGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-3604s21c1
Sequence:CCGGTGCTACAACCTCGCTACTATTCTCGAGAATAGTAGCGAGGTTGTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008712.1-1983s1c1
Sequence:CCGGGCCCTGGTGGAGATTAACATTCTCGAGAATGTTAATCTCCACCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008712.1-1171s1c1
Sequence:CCGGCCAAAGAATTTCTCGACCAATCTCGAGATTGGTCGAGAAATTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008712.1-1880s1c1
Sequence:CCGGCGTTCGTGATTACTGTGACAACTCGAGTTGTCACAGTAATCACGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008712.1-1470s1c1
Sequence:CCGGGCCATCACTATATTCCCTCAACTCGAGTTGAGGGAATATAGTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-1462s21c1
Sequence:CCGGTCAGGTCGGCCATCACTATATCTCGAGATATAGTGATGGCCGACCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-4117s21c1
Sequence:CCGGAGGAGCAAGGAGGCCATATTTCTCGAGAAATATGGCCTCCTTGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008712
VALIDATED
NOS1 MISSION shRNA Lentiviral Transduction Particles
nitric oxide synthase 1 (neuronal)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-127s21c1
Sequence:CCGGAGATCCAACCCAACGTCATTTCTCGAGAAATGACGTTGGGTTGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-3950s21c1
Sequence:CCGGACAATCCAAGATAGATCATATCTCGAGATATGATCTATCTTGGATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-3604s21c1
Sequence:CCGGTGCTACAACCTCGCTACTATTCTCGAGAATAGTAGCGAGGTTGTAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008712.1-1983s1c1
Sequence:CCGGGCCCTGGTGGAGATTAACATTCTCGAGAATGTTAATCTCCACCAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008712.1-1171s1c1
Sequence:CCGGCCAAAGAATTTCTCGACCAATCTCGAGATTGGTCGAGAAATTCTTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008712.1-1880s1c1
Sequence:CCGGCGTTCGTGATTACTGTGACAACTCGAGTTGTCACAGTAATCACGAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008712.1-1470s1c1
Sequence:CCGGGCCATCACTATATTCCCTCAACTCGAGTTGAGGGAATATAGTGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-1462s21c1
Sequence:CCGGTCAGGTCGGCCATCACTATATCTCGAGATATAGTGATGGCCGACCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008712.2-4117s21c1
Sequence:CCGGAGGAGCAAGGAGGCCATATTTCTCGAGAAATATGGCCTCCTTGCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)