EMAIL THIS PAGE TO A FRIEND

NOS2

nitric oxide synthase 2, inducible

117 Gene Product Result for
Synonyms: HEP-NOS INOS NOS NOS2A
Gene ID:
Human(4843) Summary: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase which is expressed in liver and is inducible by a combination of lipopolysaccharide and certain cytokines. Three related pseudogenes are located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Mouse(18126) nitric oxide synthase 2, inducible
Rat(24599) nitric oxide synthase 2, inducible
chicken(395807) nitric oxide synthase 2, inducible
cow(282876) nitric oxide synthase 2, inducible
domestic cat(101087020) nitric oxide synthase 2, inducible
dog(403822) nitric oxide synthase 2, inducible
Goat(100860742) nitric oxide synthase 2, inducible
sheep(443078) nitric oxide synthase 2, inducible
domestic guinea pig(100135576) nitric oxide synthase 2, inducible
Domestic Rabbit(100009437) nitric oxide synthase 2, inducible
naked mole-rat(101699617) nitric oxide synthase 2, inducible
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502011 Anti-INOS antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4502012 Anti-INOS antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5500152 Anti-INOS antibody, Rabbit monoclonal clone SP126, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
N7782 Anti-Nitric Oxide Synthase, Inducible antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat
microarray, western blot pricing
SAB4200766 Anti-Nitric Oxide Synthase, Inducible antibody, Mouse monoclonal clone NOS-IN, purified from hybridoma cell culture rat, human, plant, mouse
flow cytometry, immunohistochemistry, western blot pricing
N217 Anti-Nitric Oxide Synthase, Universal antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, bovine, pig, rat, mouse
immunohistochemistry, western blot pricing
SAB4301563 Anti-phospho-iNOS (pTyr151) antibody produced in rabbit affinity isolated antibody human, rat
western blot pricing
N9657 Monoclonal Anti-Nitric Oxide Synthase, Inducible antibody produced in mouse clone NOS-IN, ascites fluid rat, mouse
microarray, western blot pricing
SAB1402859 Monoclonal Anti-NOS2 antibody produced in mouse clone 2G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
R3255 13-cis-Retinoic acid ≥98% (HPLC) human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P0547 Pentamidine isethionate salt powder human pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
T4376 N-p-Tosyl-L-phenylalanine chloromethyl ketone ≥97% (TLC), powder human pricing

Small Molecule - Cofactor

Product # Description Species Add to Cart
 
S154 Sepiapterin solid human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T7313 1-[2-(Trifluoromethyl)phenyl]imidazole human pricing
W4262 1400W dihydrochloride >98%, solid human pricing
O3636 1H-[1,2,4]Oxadiazolo[4,3-a]quinoxalin-1-one powder human pricing
A5879 2-(2-Aminoethyl)isothiourea dihydrobromide human pricing
A51807 2-Amino-4,6-dimethylpyridine 99% human pricing
A7009 Aminoguanidine hemisulfate salt ≥98% human pricing
P8765 Ammonium pyrrolidinedithiocarbamate ~99% human pricing
C9758 L-Canavanine sulfate salt ≥99% (TLC), powder human pricing
I8021 L-N6-(1-Iminoethyl)lysine dihydrochloride human pricing
M5250 Melatonin powder, ≥98% (TLC) human pricing
D4268 NG,NG-Dimethylarginine dihydrochloride human pricing
P1061 Proadifen hydrochloride analytical standard, ≥95% human pricing
M5171 S-Methyl-L-thiocitrulline acetate salt ≥98% (TLC) human pricing
D2926 Diphenyleneiodonium chloride ≥98% human, mouse pricing
T144 (±)-Thalidomide ≥98%, powder human, mouse, rat pricing
T151 (+)-Thalidomide ≥98% (HPLC), powder human, mouse, rat pricing
T150 (−)-Thalidomide >98%, solid human, mouse, rat pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
B7005 Betamethasone ≥98% human, mouse, rat pricing
B9675 Betamethasone meets USP testing specifications human, mouse, rat pricing
D1756 Dexamethasone ≥98% (HPLC), powder human, mouse, rat pricing
D4902 Dexamethasone powder, BioReagent, suitable for cell culture, ≥97% human, mouse, rat pricing
D8893 Dexamethasone powder, γ-irradiated, BioXtra, suitable for cell culture, ≥80% (HPLC) human, mouse, rat pricing
D9184 Dexamethasone meets USP testing specifications human, mouse, rat pricing
31375 Dexamethasone tested according to Ph Eur human, mouse, rat pricing
H4001 Hydrocortisone ≥98% (HPLC) human, mouse, rat pricing
H0135 Hydrocortisone γ-irradiated, powder, BioXtra, suitable for cell culture human, mouse, rat pricing
H0888 Hydrocortisone BioReagent, suitable for cell culture human, mouse, rat pricing
H3160 Hydrocortisone meets USP testing specifications human, mouse, rat pricing
H6909 Hydrocortisone solution 50 μM, sterile-filtered, BioXtra, suitable for cell culture human, mouse, rat pricing
H0396 Hydrocortisone-Water Soluble BioReagent, suitable for cell culture human, mouse, rat pricing
M7033 NG-Methyl-L-arginine acetate salt ≥98% (TLC) human, mouse, rat pricing
N5501 Nω-Nitro-L-arginine ≥98% (TLC) human, mouse, rat pricing
R5010 Resveratrol ≥99% (HPLC) human, mouse, rat pricing
88544 Thio-L-citrulline ≥98.0% human, mouse, rat pricing
123080 2-Amino-4-methylpyridine 99% human, rat pricing
N7778 7-Nitroindazole ≥98% human, rat pricing
O5504 Oleanolic acid ≥97% mouse pricing
U6753 Ursolic acid ≥90% mouse pricing
U6628 Uvaol ≥95% mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000625 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038541 MISSION® esiRNA esiRNA human NOS2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000625 Rosetta Predictions human pricing
NM_153292 Rosetta Predictions human pricing
NM_012611 Rosetta Predictions rat pricing
NM_010927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212191 predicted 3590
2 SASI_Hs01_00212192 predicted 1803
3 SASI_Hs02_00302963 predicted 762
4 SASI_Hs02_00302964 predicted 269
5 SASI_Hs01_00212196 predicted 2031
6 SASI_Hs01_00212197 predicted 559
7 SASI_Hs02_00302965 predicted 1587
8 SASI_Hs01_00212199 predicted 2176
9 SASI_Hs01_00212200 predicted 3620
10 SASI_Hs02_00302966 predicted 1815
11 SASI_Hs01_00212193 predicted 2478
12 SASI_Hs01_00212194 predicted 2456
13 SASI_Hs01_00212195 predicted 2447
14 SASI_Hs01_00212198 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215397 predicted 3483
2 SASI_Hs01_00215398 predicted 1686
3 SASI_Hs01_00215399 predicted 2357
4 SASI_Hs01_00215400 predicted 2339
5 SASI_Hs01_00215401 predicted 2330
6 SASI_Hs01_00215402 predicted 1914
7 SASI_Hs01_00215403 predicted 565
8 SASI_Hs01_00215404 predicted 299
9 SASI_Hs01_00215405 predicted 2064
10 SASI_Hs01_00215406 predicted 3508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103420 predicted 490
2 SASI_Rn02_00259798 predicted 3549
3 SASI_Rn02_00259799 predicted 2364
4 SASI_Rn01_00103421 predicted 1624
5 SASI_Rn02_00259800 predicted 3405
6 SASI_Rn01_00103425 predicted 876
7 SASI_Rn01_00103428 predicted 625
8 SASI_Rn02_00259801 predicted 1936
9 SASI_Rn01_00103429 predicted 2770
10 SASI_Rn02_00259802 predicted 837
11 SASI_Rn01_00103422 predicted 1923
12 SASI_Rn01_00103423 predicted 856
13 SASI_Rn01_00103424 predicted 2226
14 SASI_Rn01_00103426 predicted 1750
15 SASI_Rn01_00103427 predicted 3413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189239 predicted 1905
2 SASI_Mm01_00189240 predicted 1982
3 SASI_Mm01_00189241 predicted 243
4 SASI_Mm01_00189242 predicted 2381
5 SASI_Mm01_00189243 predicted 1925
6 SASI_Mm01_00189244 predicted 605
7 SASI_Mm01_00189245 predicted 592
8 SASI_Mm02_00319672 predicted 3490
9 SASI_Mm01_00189247 predicted 1852
10 SASI_Mm01_00189248 predicted 1614
11 SASI_Mm01_00189246 predicted 1899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000625
NOS2 MISSION shRNA Bacterial Glycerol Stock
nitric oxide synthase 2, inducible
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-1782s1c1
Sequence:CCGGGAGACCCAAGAGAAGAGAGATCTCGAGATCTCTCTTCTCTTGGGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-1542s1c1
Sequence:CCGGCCAGAAGCAGAATGTGACCATCTCGAGATGGTCACATTCTGCTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-763s1c1
Sequence:CCGGGAAGCGGTAACAAAGGAGATACTCGAGTATCTCCTTTGTTACCGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000625.x-4060s1c1
Sequence:CCGGTGTGTATTTAACTGCCTTGTGCTCGAGCACAAGGCAGTTAAATACACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-3594s1c1
Sequence:CCGGCGAGGACTATTTCTTTCAGCTCTCGAGAGCTGAAAGAAATAGTCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-682s21c1
Sequence:CCGGCTACCTCAAGCTATCGAATTTCTCGAGAAATTCGATAGCTTGAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000625.3-3770s21c1
Sequence:CCGGATGGAGCCAGCTCTGCATTATCTCGAGATAATGCAGAGCTGGCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-3624s21c1
Sequence:CCGGGAAGCGCTATCACGAAGATATCTCGAGATATCTTCGTGATAGCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-1505s21c1
Sequence:CCGGCTGTCGTTGAGATCAACATTGCTCGAGCAATGTTGATCTCAACGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-3584s21c1
Sequence:CCGGAGGAGCAGGTCGAGGACTATTCTCGAGAATAGTCCTCGACCTGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000625
NOS2 MISSION shRNA shRNA Plasmid DNA
nitric oxide synthase 2, inducible
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-1782s1c1
Sequence:CCGGGAGACCCAAGAGAAGAGAGATCTCGAGATCTCTCTTCTCTTGGGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-1542s1c1
Sequence:CCGGCCAGAAGCAGAATGTGACCATCTCGAGATGGTCACATTCTGCTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-763s1c1
Sequence:CCGGGAAGCGGTAACAAAGGAGATACTCGAGTATCTCCTTTGTTACCGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000625.x-4060s1c1
Sequence:CCGGTGTGTATTTAACTGCCTTGTGCTCGAGCACAAGGCAGTTAAATACACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-3594s1c1
Sequence:CCGGCGAGGACTATTTCTTTCAGCTCTCGAGAGCTGAAAGAAATAGTCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-682s21c1
Sequence:CCGGCTACCTCAAGCTATCGAATTTCTCGAGAAATTCGATAGCTTGAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000625.3-3770s21c1
Sequence:CCGGATGGAGCCAGCTCTGCATTATCTCGAGATAATGCAGAGCTGGCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-3624s21c1
Sequence:CCGGGAAGCGCTATCACGAAGATATCTCGAGATATCTTCGTGATAGCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-1505s21c1
Sequence:CCGGCTGTCGTTGAGATCAACATTGCTCGAGCAATGTTGATCTCAACGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-3584s21c1
Sequence:CCGGAGGAGCAGGTCGAGGACTATTCTCGAGAATAGTCCTCGACCTGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000625
NOS2 MISSION shRNA Lentiviral Transduction Particles
nitric oxide synthase 2, inducible
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-1782s1c1
Sequence:CCGGGAGACCCAAGAGAAGAGAGATCTCGAGATCTCTCTTCTCTTGGGTCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-1542s1c1
Sequence:CCGGCCAGAAGCAGAATGTGACCATCTCGAGATGGTCACATTCTGCTTCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-763s1c1
Sequence:CCGGGAAGCGGTAACAAAGGAGATACTCGAGTATCTCCTTTGTTACCGCTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000625.x-4060s1c1
Sequence:CCGGTGTGTATTTAACTGCCTTGTGCTCGAGCACAAGGCAGTTAAATACACATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000625.x-3594s1c1
Sequence:CCGGCGAGGACTATTTCTTTCAGCTCTCGAGAGCTGAAAGAAATAGTCCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-682s21c1
Sequence:CCGGCTACCTCAAGCTATCGAATTTCTCGAGAAATTCGATAGCTTGAGGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000625.3-3770s21c1
Sequence:CCGGATGGAGCCAGCTCTGCATTATCTCGAGATAATGCAGAGCTGGCTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-3624s21c1
Sequence:CCGGGAAGCGCTATCACGAAGATATCTCGAGATATCTTCGTGATAGCGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-1505s21c1
Sequence:CCGGCTGTCGTTGAGATCAACATTGCTCGAGCAATGTTGATCTCAACGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000625.3-3584s21c1
Sequence:CCGGAGGAGCAGGTCGAGGACTATTCTCGAGAATAGTCCTCGACCTGCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010927
NOS2 MISSION shRNA Bacterial Glycerol Stock
nitric oxide synthase 2, inducible
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010927.1-3742s1c1
Sequence:CCGGGTATTGTACTATTGTGGACTACTCGAGTAGTCCACAATAGTACAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-668s1c1
Sequence:CCGGGCTGTAACAAAGGAAATAGAACTCGAGTTCTATTTCCTTTGTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-610s1c1
Sequence:CCGGCCAGTATTATGGCTCCTTTAACTCGAGTTAAAGGAGCCATAATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-1618s1c1
Sequence:CCGGCCTATCTCCATTCTACTACTACTCGAGTAGTAGTAGAATGGAGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-2281s1c1
Sequence:CCGGGCCACAGCAATATAGGCTCATCTCGAGATGAGCCTATATTGCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010927
NOS2 MISSION shRNA shRNA Plasmid DNA
nitric oxide synthase 2, inducible
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010927.1-3742s1c1
Sequence:CCGGGTATTGTACTATTGTGGACTACTCGAGTAGTCCACAATAGTACAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-668s1c1
Sequence:CCGGGCTGTAACAAAGGAAATAGAACTCGAGTTCTATTTCCTTTGTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-610s1c1
Sequence:CCGGCCAGTATTATGGCTCCTTTAACTCGAGTTAAAGGAGCCATAATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-1618s1c1
Sequence:CCGGCCTATCTCCATTCTACTACTACTCGAGTAGTAGTAGAATGGAGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-2281s1c1
Sequence:CCGGGCCACAGCAATATAGGCTCATCTCGAGATGAGCCTATATTGCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010927
NOS2 MISSION shRNA Lentiviral Transduction Particles
nitric oxide synthase 2, inducible
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010927.1-3742s1c1
Sequence:CCGGGTATTGTACTATTGTGGACTACTCGAGTAGTCCACAATAGTACAATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-668s1c1
Sequence:CCGGGCTGTAACAAAGGAAATAGAACTCGAGTTCTATTTCCTTTGTTACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-610s1c1
Sequence:CCGGCCAGTATTATGGCTCCTTTAACTCGAGTTAAAGGAGCCATAATACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-1618s1c1
Sequence:CCGGCCTATCTCCATTCTACTACTACTCGAGTAGTAGTAGAATGGAGATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010927.1-2281s1c1
Sequence:CCGGGCCACAGCAATATAGGCTCATCTCGAGATGAGCCTATATTGCTGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)