EMAIL THIS PAGE TO A FRIEND

NOSIP

nitric oxide synthase interacting protein

49 Gene Product Result for
UniProtKB ID: Q9Y314, Q96FD2
Gene ID:
Human(51070) Summary: The protein encoded by this gene may modulate the activity and localization of nitric oxide synthase (endothelial and neuronal) and thus nitric oxide production. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Aug 2012]
Mouse(66394) nitric oxide synthase interacting protein
Rat(292894) nitric oxide synthase interacting protein
sheep(101106872) nitric oxide synthase interacting protein
domestic guinea pig(100725990) nitric oxide synthase interacting protein
naked mole-rat(101724413) nitric oxide synthase interacting protein
Zebrafish(492793) nitric oxide synthase interacting protein
dog(484378) nitric oxide synthase interacting protein
cow(511234) nitric oxide synthase interacting protein
domestic cat(101096687) nitric oxide synthase interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015953 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025533 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025533 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025533 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015953 Rosetta Predictions human pricing
NM_001106260 Rosetta Predictions rat pricing
NM_025533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025537 predicted 389
2 SASI_Hs01_00025538 predicted 601
3 SASI_Hs01_00025539 predicted 596
4 SASI_Hs01_00025540 predicted 587
5 SASI_Hs01_00025541 predicted 737
6 SASI_Hs01_00025542 predicted 394
7 SASI_Hs01_00025543 predicted 582
8 SASI_Hs01_00025544 predicted 363
9 SASI_Hs01_00025545 predicted 556
10 SASI_Hs01_00025546 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217218 predicted 288
2 SASI_Rn02_00217219 predicted 1058
3 SASI_Rn02_00217220 predicted 959
4 SASI_Rn02_00217221 predicted 855
5 SASI_Rn02_00217222 predicted 924
6 SASI_Rn02_00217223 predicted 628
7 SASI_Rn02_00217224 predicted 538
8 SASI_Rn02_00217225 predicted 1044
9 SASI_Rn02_00217226 predicted 1085
10 SASI_Rn02_00217227 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100688 predicted 292
2 SASI_Mm01_00100689 predicted 657
3 SASI_Mm01_00100690 predicted 536
4 SASI_Mm01_00100691 predicted 626
5 SASI_Mm01_00100692 predicted 228
6 SASI_Mm01_00100693 predicted 368
7 SASI_Mm01_00100694 predicted 251
8 SASI_Mm01_00100695 predicted 489
9 SASI_Mm01_00100696 predicted 640
10 SASI_Mm01_00100697 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015953
VALIDATED
NOSIP MISSION shRNA Bacterial Glycerol Stock
nitric oxide synthase interacting protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-271s1c1
Sequence:CCGGTGAAGGACTTCGACTGCTGTTCTCGAGAACAGCAGTCGAAGTCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015953.3-375s1c1
Sequence:CCGGCTGCACCAGAAGAAGGAGATTCTCGAGAATCTCCTTCTTCTGGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-603s1c1
Sequence:CCGGCCAAGTAAGGACAAGGACAAACTCGAGTTTGTCCTTGTCCTTACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-908s1c1
Sequence:CCGGGAAGCTGATTCGGAAGGACATCTCGAGATGTCCTTCCGAATCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-188s1c1
Sequence:CCGGCGTCTACACCTACCACGAGAACTCGAGTTCTCGTGGTAGGTGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015953
VALIDATED
NOSIP MISSION shRNA shRNA Plasmid DNA
nitric oxide synthase interacting protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-271s1c1
Sequence:CCGGTGAAGGACTTCGACTGCTGTTCTCGAGAACAGCAGTCGAAGTCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015953.3-375s1c1
Sequence:CCGGCTGCACCAGAAGAAGGAGATTCTCGAGAATCTCCTTCTTCTGGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-603s1c1
Sequence:CCGGCCAAGTAAGGACAAGGACAAACTCGAGTTTGTCCTTGTCCTTACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-908s1c1
Sequence:CCGGGAAGCTGATTCGGAAGGACATCTCGAGATGTCCTTCCGAATCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-188s1c1
Sequence:CCGGCGTCTACACCTACCACGAGAACTCGAGTTCTCGTGGTAGGTGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015953
VALIDATED
NOSIP MISSION shRNA Lentiviral Transduction Particles
nitric oxide synthase interacting protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-271s1c1
Sequence:CCGGTGAAGGACTTCGACTGCTGTTCTCGAGAACAGCAGTCGAAGTCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015953.3-375s1c1
Sequence:CCGGCTGCACCAGAAGAAGGAGATTCTCGAGAATCTCCTTCTTCTGGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-603s1c1
Sequence:CCGGCCAAGTAAGGACAAGGACAAACTCGAGTTTGTCCTTGTCCTTACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-908s1c1
Sequence:CCGGGAAGCTGATTCGGAAGGACATCTCGAGATGTCCTTCCGAATCAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015953.3-188s1c1
Sequence:CCGGCGTCTACACCTACCACGAGAACTCGAGTTCTCGTGGTAGGTGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025533
VALIDATED
NOSIP MISSION shRNA Bacterial Glycerol Stock
nitric oxide synthase interacting protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-526s1c1
Sequence:CCGGGCTTCTGGATTCCCTCACTAACTCGAGTTAGTGAGGGAATCCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-83s1c1
Sequence:CCGGCTACACCTACCACGAGAAGAACTCGAGTTCTTCTCGTGGTAGGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-785s1c1
Sequence:CCGGCCTGGAGTGTGTTGAGAAACTCTCGAGAGTTTCTCAACACACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025533.1-233s1c1
Sequence:CCGGCCTGTATGAGAGGGAAGCGATCTCGAGATCGCTTCCCTCTCATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-369s1c1
Sequence:CCGGGACCAAGTTAGAGGCTTCCTACTCGAGTAGGAAGCCTCTAACTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025533.3-1217s21c1
Sequence:CCGGGAAGTGCAAGTCTCGTGATAGCTCGAGCTATCACGAGACTTGCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025533.3-1131s21c1
Sequence:CCAGCACTTAGGACCAGGCAGAAACCTCGAGGTTTCTGCCTGGTCCTAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025533.3-218s21c1
Sequence:CCGGGGGACGCTGTGAAAGACTTTGCTCGAGCAAAGTCTTTCACAGCGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025533
VALIDATED
NOSIP MISSION shRNA shRNA Plasmid DNA
nitric oxide synthase interacting protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-526s1c1
Sequence:CCGGGCTTCTGGATTCCCTCACTAACTCGAGTTAGTGAGGGAATCCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-83s1c1
Sequence:CCGGCTACACCTACCACGAGAAGAACTCGAGTTCTTCTCGTGGTAGGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-785s1c1
Sequence:CCGGCCTGGAGTGTGTTGAGAAACTCTCGAGAGTTTCTCAACACACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025533.1-233s1c1
Sequence:CCGGCCTGTATGAGAGGGAAGCGATCTCGAGATCGCTTCCCTCTCATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-369s1c1
Sequence:CCGGGACCAAGTTAGAGGCTTCCTACTCGAGTAGGAAGCCTCTAACTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025533.3-1217s21c1
Sequence:CCGGGAAGTGCAAGTCTCGTGATAGCTCGAGCTATCACGAGACTTGCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025533.3-1131s21c1
Sequence:CCAGCACTTAGGACCAGGCAGAAACCTCGAGGTTTCTGCCTGGTCCTAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025533.3-218s21c1
Sequence:CCGGGGGACGCTGTGAAAGACTTTGCTCGAGCAAAGTCTTTCACAGCGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025533
VALIDATED
NOSIP MISSION shRNA Lentiviral Transduction Particles
nitric oxide synthase interacting protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-526s1c1
Sequence:CCGGGCTTCTGGATTCCCTCACTAACTCGAGTTAGTGAGGGAATCCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-83s1c1
Sequence:CCGGCTACACCTACCACGAGAAGAACTCGAGTTCTTCTCGTGGTAGGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-785s1c1
Sequence:CCGGCCTGGAGTGTGTTGAGAAACTCTCGAGAGTTTCTCAACACACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025533.1-233s1c1
Sequence:CCGGCCTGTATGAGAGGGAAGCGATCTCGAGATCGCTTCCCTCTCATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025533.1-369s1c1
Sequence:CCGGGACCAAGTTAGAGGCTTCCTACTCGAGTAGGAAGCCTCTAACTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025533.3-1217s21c1
Sequence:CCGGGAAGTGCAAGTCTCGTGATAGCTCGAGCTATCACGAGACTTGCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025533.3-1131s21c1
Sequence:CCAGCACTTAGGACCAGGCAGAAACCTCGAGGTTTCTGCCTGGTCCTAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025533.3-218s21c1
Sequence:CCGGGGGACGCTGTGAAAGACTTTGCTCGAGCAAAGTCTTTCACAGCGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)