EMAIL THIS PAGE TO A FRIEND

NOSTRIN

nitric oxide synthase trafficking

81 Gene Product Result for
Synonyms: DaIP2
Gene ID:
Human(115677) Summary: Nitric oxide (NO) is a potent mediator in biologic processes such as neurotransmission, inflammatory response, and vascular homeostasis. NOSTRIN binds the enzyme responsible for NO production, endothelial NO synthase (ENOS; MIM 163729), and triggers the translocation of ENOS from the plasma membrane to vesicle-like subcellular structures, thereby attenuating ENOS-dependent NO production.[supplied by OMIM, Apr 2004]
Mouse(329416) nitric oxide synthase trafficker
Rat(311111) nitric oxide synthase trafficking
Zebrafish(100148449) nitric oxide synthase trafficker
cow(521834) nitric oxide synthase trafficker
domestic cat(101084813) nitric oxide synthase trafficker
dog(478780) nitric oxide synthase trafficker
naked mole-rat(101713879) nitric oxide synthase trafficker
domestic guinea pig(100714437) nitric oxide synthase trafficker
sheep(101122001) nitric oxide synthase trafficker
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052946 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039724 Rosetta Predictions human pricing
NM_052946 Rosetta Predictions human pricing
NM_001024260 Rosetta Predictions rat pricing
NM_181547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094741 predicted 613
2 SASI_Hs01_00094742 predicted 1027
3 SASI_Hs01_00094743 predicted 867
4 SASI_Hs01_00094744 predicted 673
5 SASI_Hs02_00308657 predicted 859
6 SASI_Hs01_00094745 predicted 1090
7 SASI_Hs02_00308658 predicted 1183
8 SASI_Hs01_00094748 predicted 734
9 SASI_Hs01_00094750 predicted 885
10 SASI_Hs02_00308659 predicted 1359
11 SASI_Hs01_00094746 predicted 348
12 SASI_Hs01_00094747 predicted 493
13 SASI_Hs01_00094749 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215647 predicted 571
2 SASI_Hs01_00215648 predicted 980
3 SASI_Hs01_00215649 predicted 828
4 SASI_Hs01_00215650 predicted 632
5 SASI_Hs02_00361735 predicted 826
6 SASI_Hs01_00215651 predicted 1043
7 SASI_Hs02_00361736 predicted 1142
8 SASI_Hs01_00215654 predicted 694
9 SASI_Hs01_00215656 predicted 844
10 SASI_Hs02_00361737 predicted 1317
11 SASI_Hs01_00215652 predicted 309
12 SASI_Hs01_00215653 predicted 445
13 SASI_Hs01_00215655 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118876 predicted 214
2 SASI_Rn01_00118877 predicted 623
3 SASI_Rn01_00118878 predicted 1071
4 SASI_Rn01_00118879 predicted 318
5 SASI_Rn02_00202422 predicted 903
6 SASI_Rn01_00118881 predicted 1134
7 SASI_Rn01_00118882 predicted 1370
8 SASI_Rn01_00118883 predicted 626
9 SASI_Rn01_00118885 predicted 725
10 SASI_Rn02_00202423 predicted 1312
11 SASI_Rn01_00118880 predicted 414
12 SASI_Rn01_00118884 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088236 predicted 1081
2 SASI_Mm01_00088237 predicted 215
3 SASI_Mm01_00088238 predicted 902
4 SASI_Mm01_00088239 predicted 313
5 SASI_Mm01_00088240 predicted 1397
6 SASI_Mm01_00088241 predicted 1359
7 SASI_Mm02_00349827 predicted 206
8 SASI_Mm01_00088242 predicted 1127
9 SASI_Mm02_00349828 predicted 1300
10 SASI_Mm02_00349829 predicted 1077
11 SASI_Mm01_00088243 predicted 1354
12 SASI_Mm01_00088244 predicted 1327
13 SASI_Mm01_00088245 predicted 844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181547
VALIDATED
NOSTRIN MISSION shRNA Bacterial Glycerol Stock
nitric oxide synthase trafficking
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181547.2-931s1c1
Sequence:CCGGGCGACGGAAGTCTTTATTAAACTCGAGTTTAATAAAGACTTCCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181547.2-1225s1c1
Sequence:CCGGGCACTCTCATACTTATGTGAACTCGAGTTCACATAAGTATGAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181547.2-317s1c1
Sequence:CCGGGCAATTGAGTTGGAAGCGATACTCGAGTATCGCTTCCAACTCAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181547.2-384s1c1
Sequence:CCGGCGCTTGATAATGAAGTGGAAACTCGAGTTTCCACTTCATTATCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181547.2-1594s1c1
Sequence:CCGGCTTTGCACATTCTGTAAACAACTCGAGTTGTTTACAGAATGTGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181547
VALIDATED
NOSTRIN MISSION shRNA shRNA Plasmid DNA
nitric oxide synthase trafficking
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181547.2-931s1c1
Sequence:CCGGGCGACGGAAGTCTTTATTAAACTCGAGTTTAATAAAGACTTCCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181547.2-1225s1c1
Sequence:CCGGGCACTCTCATACTTATGTGAACTCGAGTTCACATAAGTATGAGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181547.2-317s1c1
Sequence:CCGGGCAATTGAGTTGGAAGCGATACTCGAGTATCGCTTCCAACTCAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181547.2-384s1c1
Sequence:CCGGCGCTTGATAATGAAGTGGAAACTCGAGTTTCCACTTCATTATCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181547.2-1594s1c1
Sequence:CCGGCTTTGCACATTCTGTAAACAACTCGAGTTGTTTACAGAATGTGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181547
VALIDATED
NOSTRIN MISSION shRNA Lentiviral Transduction Particles
nitric oxide synthase trafficking
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181547.2-931s1c1
Sequence:CCGGGCGACGGAAGTCTTTATTAAACTCGAGTTTAATAAAGACTTCCGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181547.2-1225s1c1
Sequence:CCGGGCACTCTCATACTTATGTGAACTCGAGTTCACATAAGTATGAGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181547.2-317s1c1
Sequence:CCGGGCAATTGAGTTGGAAGCGATACTCGAGTATCGCTTCCAACTCAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181547.2-384s1c1
Sequence:CCGGCGCTTGATAATGAAGTGGAAACTCGAGTTTCCACTTCATTATCAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181547.2-1594s1c1
Sequence:CCGGCTTTGCACATTCTGTAAACAACTCGAGTTGTTTACAGAATGTGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052946
NOSTRIN MISSION shRNA Bacterial Glycerol Stock
nitric oxide synthase trafficking
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-262s1c2
Sequence:CCGGCCGACTTATCAAGTCCTAAATCTCGAGATTTAGGACTTGATAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-262s1c1
Sequence:CCGGCCGACTTATCAAGTCCTAAATCTCGAGATTTAGGACTTGATAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-1003s1c1
Sequence:CCGGGCGTTAATGGATGAGAACAATCTCGAGATTGTTCTCATCCATTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-1146s1c1
Sequence:CCGGGCATACTCATAGCTATGTGAACTCGAGTTCACATAGCTATGAGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-1429s1c1
Sequence:CCGGGCCGCTTATGTGGAGGAGTTACTCGAGTAACTCCTCCACATAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-347s1c1
Sequence:CCGGGCAACTGGAATCAGCAAATTACTCGAGTAATTTGCTGATTCCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052946
NOSTRIN MISSION shRNA shRNA Plasmid DNA
nitric oxide synthase trafficking
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-262s1c2
Sequence:CCGGCCGACTTATCAAGTCCTAAATCTCGAGATTTAGGACTTGATAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-262s1c1
Sequence:CCGGCCGACTTATCAAGTCCTAAATCTCGAGATTTAGGACTTGATAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-1003s1c1
Sequence:CCGGGCGTTAATGGATGAGAACAATCTCGAGATTGTTCTCATCCATTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-1146s1c1
Sequence:CCGGGCATACTCATAGCTATGTGAACTCGAGTTCACATAGCTATGAGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-1429s1c1
Sequence:CCGGGCCGCTTATGTGGAGGAGTTACTCGAGTAACTCCTCCACATAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-347s1c1
Sequence:CCGGGCAACTGGAATCAGCAAATTACTCGAGTAATTTGCTGATTCCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052946
NOSTRIN MISSION shRNA Lentiviral Transduction Particles
nitric oxide synthase trafficking
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-262s1c2
Sequence:CCGGCCGACTTATCAAGTCCTAAATCTCGAGATTTAGGACTTGATAAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-262s1c1
Sequence:CCGGCCGACTTATCAAGTCCTAAATCTCGAGATTTAGGACTTGATAAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-1003s1c1
Sequence:CCGGGCGTTAATGGATGAGAACAATCTCGAGATTGTTCTCATCCATTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-1146s1c1
Sequence:CCGGGCATACTCATAGCTATGTGAACTCGAGTTCACATAGCTATGAGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-1429s1c1
Sequence:CCGGGCCGCTTATGTGGAGGAGTTACTCGAGTAACTCCTCCACATAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052946.2-347s1c1
Sequence:CCGGGCAACTGGAATCAGCAAATTACTCGAGTAATTTGCTGATTCCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)