EMAIL THIS PAGE TO A FRIEND

NOTCH1

notch 1

112 Gene Product Result for
Synonyms: TAN1 hN1
UniProtKB ID: P46531, Q59ED8, Q5SXM3
Gene ID:
Human(4851) Summary: This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play multiple roles during development. [provided by RefSeq, Jul 2008]
Mouse(18128) notch 1
Rat(25496) notch 1
chicken(395655) notch 1
dog(480676) notch 1
cow(767866) notch 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
05-557 Anti-Notch 1 Antibody, clone 8G10 culture supernatant, clone 8G10, Upstate® mouse, rat
flow cytometry, immunocytochemistry, western blot pricing
MAB5352 Anti-Notch 1 Antibody, clone mN1A clone mN1A, Chemicon®, from mouse feline, mouse, rat
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MAB5414 Anti-Notch 1 Antibody, extracellular, clone 8G10 culture supernatant, clone 8G10, Chemicon® rat, mouse
flow cytometry, immunohistochemistry, western blot pricing
07-1232 Anti-Notch 1 Antibody, NT serum, from rabbit mouse, human, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502019 Anti-NOTCH1 (Cleaved-Val1754) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB5700255 Anti-NOTCH1 antibody produced in rabbit mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA067168 Anti-NOTCH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2101618 Anti-NOTCH1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
N4788 Anti-NOTCH1 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunohistochemistry, western blot pricing
07-1231 Anti-Notch1 Antibody, Intracellular serum, from rabbit human, human
ELISA, immunohistochemistry, western blot pricing
N6786 Anti-Notch1 antibody, Mouse monoclonal clone mN1A, purified from hybridoma cell culture mouse, human
ELISA, immunocytochemistry, microarray, western blot pricing
SAB4700742 Monoclonal Anti-Notch 1 antibody produced in mouse clone mN1A, purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4200024 Monoclonal Anti-Notch 1 antibody produced in rat ~1.0 mg/mL, clone ICN 5B5, purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4701110 Monoclonal Anti-Notch 1-APC antibody produced in mouse clone mN1A flow cytometry pricing
SAB5200915 Monoclonal Anti-Notch1 - Alkaline Phosphatase antibody produced in mouse clone S253-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200916 Monoclonal Anti-Notch1 - Apc antibody produced in mouse clone S253-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200907 Monoclonal Anti-Notch1 - Atto 390 antibody produced in mouse clone S253-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200908 Monoclonal Anti-Notch1 - Atto 488 antibody produced in mouse clone S253-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200909 Monoclonal Anti-Notch1 - Atto 565 antibody produced in mouse clone S253-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200910 Monoclonal Anti-Notch1 - Atto 594 antibody produced in mouse clone S253-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200911 Monoclonal Anti-Notch1 - Atto 633 antibody produced in mouse clone S253-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200912 Monoclonal Anti-Notch1 - Atto 655 antibody produced in mouse clone S253-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200913 Monoclonal Anti-Notch1 - Atto 680 antibody produced in mouse clone S253-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200914 Monoclonal Anti-Notch1 - Atto 700 antibody produced in mouse clone S253-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200917 Monoclonal Anti-Notch1 - Biotin antibody produced in mouse clone S253-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200918 Monoclonal Anti-Notch1 - Fitc antibody produced in mouse clone S253-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200919 Monoclonal Anti-Notch1 - Hrp antibody produced in mouse clone S253-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200920 Monoclonal Anti-Notch1 - Pe/Atto 594 antibody produced in mouse clone S253-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200921 Monoclonal Anti-Notch1 - Percp antibody produced in mouse clone S253-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200922 Monoclonal Anti-Notch1 - Rpe antibody produced in mouse clone S253-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200923 Monoclonal Anti-Notch1 - Streptavidin antibody produced in mouse clone S253-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB3300078 Monoclonal Anti-Notch1 antibody produced in mouse clone 3E12, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5200906 Monoclonal Anti-Notch1 antibody produced in mouse clone S253-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB1402292 Monoclonal Anti-NOTCH1 antibody produced in mouse clone 4G1, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D5942 DAPT ≥98% (HPLC), solid human, mouse, rat pricing
L1790 L-685,458 >96% (HPLC), solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017617 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017617 Rosetta Predictions human pricing
NM_001105721 Rosetta Predictions rat pricing
NM_008714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350287 predicted 1164
2 SASI_Hs01_00052328 predicted 2261
3 SASI_Hs01_00052329 predicted 945
4 SASI_Hs01_00052331 predicted 4367
5 SASI_Hs01_00052332 predicted 2245
6 SASI_Hs01_00052333 predicted 2931
7 SASI_Hs01_00052334 predicted 3162
8 SASI_Hs01_00052335 predicted 5458
9 SASI_Hs01_00052336 predicted 6107
10 SASI_Hs01_00052337 predicted 6145
11 SASI_Hs01_00052330 predicted 6915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211876 predicted 2087
2 SASI_Rn02_00211877 predicted 4593
3 SASI_Rn02_00211878 predicted 2574
4 SASI_Rn02_00211879 predicted 813
5 SASI_Rn02_00211880 predicted 5334
6 SASI_Rn02_00211881 predicted 4610
7 SASI_Rn02_00211882 predicted 5663
8 SASI_Rn02_00211883 predicted 1942
9 SASI_Rn02_00211884 predicted 4550
10 SASI_Rn02_00211885 predicted 5074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104901 predicted 5511
2 SASI_Mm01_00104902 predicted 4924
3 SASI_Mm02_00314552 predicted 2061
4 SASI_Mm01_00104903 predicted 2434
5 SASI_Mm01_00104904 predicted 4453
6 SASI_Mm01_00104905 predicted 3079
7 SASI_Mm01_00104906 predicted 6088
8 SASI_Mm01_00104907 predicted 6256
9 SASI_Mm01_00104908 predicted 2493
10 SASI_Mm01_00104910 predicted 3191
11 SASI_Mm01_00104909 predicted 4834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017617
VALIDATED
NOTCH1 MISSION shRNA Bacterial Glycerol Stock
notch 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017617.x-6960s1c1
Sequence:CCGGGCCGAACCAATACAACCCTCTCTCGAGAGAGGGTTGTATTGGTTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017617.x-903s1c1
Sequence:CCGGGATGCCAAATGCCTGCCAGAACTCGAGTTCTGGCAGGCATTTGGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017617.x-8393s1c1
Sequence:CCGGCTTTGTTTCAGGTTCAGTATTCTCGAGAATACTGAACCTGAAACAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017617.3-2401s21c1
Sequence:CCGGCTGAACCAGGGCACGTGTATTCTCGAGAATACACGTGCCCTGGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017617.3-7649s21c1
Sequence:CCGGTTCCGGAGGCCTTCAAGTAAACTCGAGTTTACTTGAAGGCCTCCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017617.x-2304s1c1
Sequence:CCGGCAAAGACATGACCAGTGGCTACTCGAGTAGCCACTGGTCATGTCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017617.3-8066s21c1
Sequence:CCGGAGGGAAGTTGAACGAGCATAGCTCGAGCTATGCTCGTTCAACTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017617.3-1510s21c1
Sequence:CCGGCGCTGCCTGGACAAGATCAATCTCGAGATTGATCTTGTCCAGGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017617.3-6258s21c1
Sequence:CCGGCCGGGACATCACGGATCATATCTCGAGATATGATCCGTGATGTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017617
VALIDATED
NOTCH1 MISSION shRNA shRNA Plasmid DNA
notch 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017617.x-6960s1c1
Sequence:CCGGGCCGAACCAATACAACCCTCTCTCGAGAGAGGGTTGTATTGGTTCGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017617.x-903s1c1
Sequence:CCGGGATGCCAAATGCCTGCCAGAACTCGAGTTCTGGCAGGCATTTGGCATCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017617.x-8393s1c1
Sequence:CCGGCTTTGTTTCAGGTTCAGTATTCTCGAGAATACTGAACCTGAAACAAAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000320476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017617.3-2401s21c1
Sequence:CCGGCTGAACCAGGGCACGTGTATTCTCGAGAATACACGTGCCCTGGTTCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000320403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017617.3-7649s21c1
Sequence:CCGGTTCCGGAGGCCTTCAAGTAAACTCGAGTTTACTTGAAGGCCTCCGGAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017617.x-2304s1c1
Sequence:CCGGCAAAGACATGACCAGTGGCTACTCGAGTAGCCACTGGTCATGTCTTTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000350254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017617.3-8066s21c1
Sequence:CCGGAGGGAAGTTGAACGAGCATAGCTCGAGCTATGCTCGTTCAACTTCCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000350253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017617.3-1510s21c1
Sequence:CCGGCGCTGCCTGGACAAGATCAATCTCGAGATTGATCTTGTCCAGGCAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000350330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017617.3-6258s21c1
Sequence:CCGGCCGGGACATCACGGATCATATCTCGAGATATGATCCGTGATGTCCCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017617
VALIDATED
NOTCH1 MISSION shRNA Lentiviral Transduction Particles
notch 1
Human
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000003361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017617.x-6960s1c1
Sequence:CCGGGCCGAACCAATACAACCCTCTCTCGAGAGAGGGTTGTATTGGTTCGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017617.x-903s1c1
Sequence:CCGGGATGCCAAATGCCTGCCAGAACTCGAGTTCTGGCAGGCATTTGGCATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017617.x-8393s1c1
Sequence:CCGGCTTTGTTTCAGGTTCAGTATTCTCGAGAATACTGAACCTGAAACAAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017617.3-2401s21c1
Sequence:CCGGCTGAACCAGGGCACGTGTATTCTCGAGAATACACGTGCCCTGGTTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017617.3-7649s21c1
Sequence:CCGGTTCCGGAGGCCTTCAAGTAAACTCGAGTTTACTTGAAGGCCTCCGGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017617.x-2304s1c1
Sequence:CCGGCAAAGACATGACCAGTGGCTACTCGAGTAGCCACTGGTCATGTCTTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017617.3-8066s21c1
Sequence:CCGGAGGGAAGTTGAACGAGCATAGCTCGAGCTATGCTCGTTCAACTTCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017617.3-1510s21c1
Sequence:CCGGCGCTGCCTGGACAAGATCAATCTCGAGATTGATCTTGTCCAGGCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017617.3-6258s21c1
Sequence:CCGGCCGGGACATCACGGATCATATCTCGAGATATGATCCGTGATGTCCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008714
NOTCH1 MISSION shRNA Bacterial Glycerol Stock
notch 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008714.3-1085s21c1
Sequence:CCGGACGGCGTGAATACCTACAATTCTCGAGAATTGTAGGTATTCACGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-7650s1c1
Sequence:CCGGCCCACATTCCAGAGGCATTTACTCGAGTAAATGCCTCTGGAATGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-4918s1c1
Sequence:CCGGGCAGATGATCTTCCCGTACTACTCGAGTAGTACGGGAAGATCATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-547s1c1
Sequence:CCGGGCCCTTTGAGTCTTCATACATCTCGAGATGTATGAAGACTCAAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-1516s1c1
Sequence:CCGGGCCAGGTTATGAAGGTGTATACTCGAGTATACACCTTCATAACCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008714.3-6541s21c1
Sequence:CCGGGAGCGTATGCACCACGATATCCTCGAGGATATCGTGGTGCATACGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008714.3-4110s21c1
Sequence:CCGGGAACTGTGTGCAGCGTGTTAACTCGAGTTAACACGCTGCACACAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008714
NOTCH1 MISSION shRNA shRNA Plasmid DNA
notch 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008714.3-1085s21c1
Sequence:CCGGACGGCGTGAATACCTACAATTCTCGAGAATTGTAGGTATTCACGCCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-7650s1c1
Sequence:CCGGCCCACATTCCAGAGGCATTTACTCGAGTAAATGCCTCTGGAATGTGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-4918s1c1
Sequence:CCGGGCAGATGATCTTCCCGTACTACTCGAGTAGTACGGGAAGATCATCTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-547s1c1
Sequence:CCGGGCCCTTTGAGTCTTCATACATCTCGAGATGTATGAAGACTCAAAGGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-1516s1c1
Sequence:CCGGGCCAGGTTATGAAGGTGTATACTCGAGTATACACCTTCATAACCTGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000362664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008714.3-6541s21c1
Sequence:CCGGGAGCGTATGCACCACGATATCCTCGAGGATATCGTGGTGCATACGCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000362592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008714.3-4110s21c1
Sequence:CCGGGAACTGTGTGCAGCGTGTTAACTCGAGTTAACACGCTGCACACAGTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008714
NOTCH1 MISSION shRNA Lentiviral Transduction Particles
notch 1
Mouse
7 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000362593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008714.3-1085s21c1
Sequence:CCGGACGGCGTGAATACCTACAATTCTCGAGAATTGTAGGTATTCACGCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-7650s1c1
Sequence:CCGGCCCACATTCCAGAGGCATTTACTCGAGTAAATGCCTCTGGAATGTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-4918s1c1
Sequence:CCGGGCAGATGATCTTCCCGTACTACTCGAGTAGTACGGGAAGATCATCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-547s1c1
Sequence:CCGGGCCCTTTGAGTCTTCATACATCTCGAGATGTATGAAGACTCAAAGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008714.2-1516s1c1
Sequence:CCGGGCCAGGTTATGAAGGTGTATACTCGAGTATACACCTTCATAACCTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008714.3-6541s21c1
Sequence:CCGGGAGCGTATGCACCACGATATCCTCGAGGATATCGTGGTGCATACGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008714.3-4110s21c1
Sequence:CCGGGAACTGTGTGCAGCGTGTTAACTCGAGTTAACACGCTGCACACAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)