EMAIL THIS PAGE TO A FRIEND

NOTCH2

notch 2

239 Gene Product Result for
Synonyms: AGS2 HJCYS hN2
UniProtKB ID: Q04721, Q5T3X7, Q99734, Q9H240
Gene ID:
Human(4853) Summary: This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(18129) notch 2
Rat(29492) notch 2
Zebrafish(58065) notch homolog 2
chicken(374031) notch 2
cow(513730) notch 2
dog(483148) notch 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D5942 DAPT ≥98% (HPLC), solid human, mouse, rat pricing
L1790 L-685,458 >96% (HPLC), solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024408 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024408 siRNAs that have been validated in the lab human pricing
NM_024358 Rosetta Predictions rat pricing
NM_010928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024408 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068799 validated 5488
1 SASI_Hs01_00068800 validated 4537
1 SASI_Hs01_00068801 validated 3099
2 SASI_Hs01_00068802 predicted 2819
3 SASI_Hs01_00068803 predicted 3187
4 SASI_Hs01_00068804 predicted 5228
5 SASI_Hs01_00068805 predicted 4215
6 SASI_Hs01_00068807 predicted 614
7 SASI_Hs02_00356709 predicted 2683
8 SASI_Hs02_00356710 predicted 4152
9 SASI_Hs01_00068806 predicted 4897
10 SASI_Hs01_00068808 predicted 3794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121184 predicted 2867
2 SASI_Rn01_00121185 predicted 5592
3 SASI_Rn01_00121186 predicted 887
4 SASI_Rn01_00121188 predicted 5360
5 SASI_Rn01_00121190 predicted 1765
6 SASI_Rn01_00121191 predicted 1683
7 SASI_Rn02_00263928 predicted 4296
8 SASI_Rn01_00121193 predicted 7218
9 SASI_Rn02_00263929 predicted 595
10 SASI_Rn02_00263930 predicted 5376
11 SASI_Rn01_00121187 predicted 5051
12 SASI_Rn01_00121189 predicted 3607
13 SASI_Rn01_00121192 predicted 2834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146340 predicted 2524
2 SASI_Mm01_00146341 predicted 2762
3 SASI_Mm01_00146343 predicted 1148
4 SASI_Mm01_00146344 predicted 1416
5 SASI_Mm02_00319673 predicted 5253
6 SASI_Mm01_00146345 predicted 3262
7 SASI_Mm01_00146346 predicted 2113
8 SASI_Mm01_00146347 predicted 5427
9 SASI_Mm01_00146348 predicted 4051
10 SASI_Mm02_00319674 predicted 2632
11 SASI_Mm01_00146342 predicted 3694
12 SASI_Mm01_00146349 predicted 3271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010928
VALIDATED
NOTCH2 MISSION shRNA Bacterial Glycerol Stock
notch 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-923s21c1
Sequence:CCGGGAGCACCTGTGAGCGGAATATCTCGAGATATTCCGCTCACAGGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-6340s21c1
Sequence:CCGGTTCGCCTCCTGGACGAGTATACTCGAGTATACTCGTCCAGGAGGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-6944s21c1
Sequence:CCGGCGAGACCCAGTACAGTGAAATCTCGAGATTTCACTGTACTGGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-7914s21c1
Sequence:CCGGCTCGCAGCCTGAGTAACATTTCTCGAGAAATGTTACTCAGGCTGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-4881s21c1
Sequence:CCGGCACACCAACTTGCGCATTAAACTCGAGTTTAATGCGCAAGTTGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-5140s1c1
Sequence:CCGGCCTACCCTCTAGTGTCTGTTTCTCGAGAAACAGACACTAGAGGGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-1831s1c1
Sequence:CCGGCCACAGGTTTCACTGGCATATCTCGAGATATGCCAGTGAAACCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-3760s1c1
Sequence:CCGGGCATCGACCTTGTGAACCATTCTCGAGAATGGTTCACAAGGTCGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010928.1-3046s1c1
Sequence:CCGGGCTCCGACTATGTCAACAGTTCTCGAGAACTGTTGACATAGTCGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-6935s1c1
Sequence:CCGGCGAGACCCAGTACAGTGAAATCTCGAGATTTCACTGTACTGGGTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010928
VALIDATED
NOTCH2 MISSION shRNA shRNA Plasmid DNA
notch 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-923s21c1
Sequence:CCGGGAGCACCTGTGAGCGGAATATCTCGAGATATTCCGCTCACAGGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-6340s21c1
Sequence:CCGGTTCGCCTCCTGGACGAGTATACTCGAGTATACTCGTCCAGGAGGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-6944s21c1
Sequence:CCGGCGAGACCCAGTACAGTGAAATCTCGAGATTTCACTGTACTGGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-7914s21c1
Sequence:CCGGCTCGCAGCCTGAGTAACATTTCTCGAGAAATGTTACTCAGGCTGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-4881s21c1
Sequence:CCGGCACACCAACTTGCGCATTAAACTCGAGTTTAATGCGCAAGTTGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-5140s1c1
Sequence:CCGGCCTACCCTCTAGTGTCTGTTTCTCGAGAAACAGACACTAGAGGGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-1831s1c1
Sequence:CCGGCCACAGGTTTCACTGGCATATCTCGAGATATGCCAGTGAAACCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-3760s1c1
Sequence:CCGGGCATCGACCTTGTGAACCATTCTCGAGAATGGTTCACAAGGTCGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010928.1-3046s1c1
Sequence:CCGGGCTCCGACTATGTCAACAGTTCTCGAGAACTGTTGACATAGTCGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-6935s1c1
Sequence:CCGGCGAGACCCAGTACAGTGAAATCTCGAGATTTCACTGTACTGGGTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010928
VALIDATED
NOTCH2 MISSION shRNA Lentiviral Transduction Particles
notch 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-923s21c1
Sequence:CCGGGAGCACCTGTGAGCGGAATATCTCGAGATATTCCGCTCACAGGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-6340s21c1
Sequence:CCGGTTCGCCTCCTGGACGAGTATACTCGAGTATACTCGTCCAGGAGGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-6944s21c1
Sequence:CCGGCGAGACCCAGTACAGTGAAATCTCGAGATTTCACTGTACTGGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-7914s21c1
Sequence:CCGGCTCGCAGCCTGAGTAACATTTCTCGAGAAATGTTACTCAGGCTGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010928.2-4881s21c1
Sequence:CCGGCACACCAACTTGCGCATTAAACTCGAGTTTAATGCGCAAGTTGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-5140s1c1
Sequence:CCGGCCTACCCTCTAGTGTCTGTTTCTCGAGAAACAGACACTAGAGGGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-1831s1c1
Sequence:CCGGCCACAGGTTTCACTGGCATATCTCGAGATATGCCAGTGAAACCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-3760s1c1
Sequence:CCGGGCATCGACCTTGTGAACCATTCTCGAGAATGGTTCACAAGGTCGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010928.1-3046s1c1
Sequence:CCGGGCTCCGACTATGTCAACAGTTCTCGAGAACTGTTGACATAGTCGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010928.1-6935s1c1
Sequence:CCGGCGAGACCCAGTACAGTGAAATCTCGAGATTTCACTGTACTGGGTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024408
VALIDATED
NOTCH2 MISSION shRNA Bacterial Glycerol Stock
notch 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024408.2-10975s21c1
Sequence:CCGGTACCTCATGATGTCATAATTTCTCGAGAAATTATGACATCATGAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-6747s21c1
Sequence:CCGGCCACATCCTCTCCAATGATTACTCGAGTAATCATTGGAGAGGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2624s21c1
Sequence:CCGGTATAACTGCCAGGTGAATATTCTCGAGAATATTCACCTGGCAGTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-4429s21c1
Sequence:CCGGTCAGCGCCAGCCTCCTTATTACTCGAGTAATAAGGAGGCTGGCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024408.2-4976s21c1
Sequence:CCGGCACACCAACCTGCGCATTAAGCTCGAGCTTAATGCGCAGGTTGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2859s21c1
Sequence:CCGGAGCGGTGTACCATTGACATTGCTCGAGCAATGTCAATGGTACACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2461s21c1
Sequence:CCGGTGGAGGTCTCAGTGGATATAACTCGAGTTATATCCACTGAGACCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024408.2-7643s1c1
Sequence:CCGGCCACACAACAACATGCAGGTTCTCGAGAACCTGCATGTTGTTGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024408.2-10688s1c1
Sequence:CCGGCCCACTAATAAGTGGTACTATCTCGAGATAGTACCACTTATTAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_024408.2-2736s1c1
Sequence:CCGGGCAAGAATTGTCAGACAGTATCTCGAGATACTGTCTGACAATTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-9642s21c1
Sequence:CCGGTGCGTGTCTGTTGGCATAATACTCGAGTATTATGCCAACAGACACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-6334s21c1
Sequence:CCGGCAAGATCCTGTTAGACCATTTCTCGAGAAATGGTCTAACAGGATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024408.2-6072s1c1
Sequence:CCGGCCAGGATGAATGATGGTACTACTCGAGTAGTACCATCATTCATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2357s21c1
Sequence:CCGGGTGAATGGTTTCCGCTGTATACTCGAGTATACAGCGGAAACCATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024408
VALIDATED
NOTCH2 MISSION shRNA shRNA Plasmid DNA
notch 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024408.2-10975s21c1
Sequence:CCGGTACCTCATGATGTCATAATTTCTCGAGAAATTATGACATCATGAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-6747s21c1
Sequence:CCGGCCACATCCTCTCCAATGATTACTCGAGTAATCATTGGAGAGGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2624s21c1
Sequence:CCGGTATAACTGCCAGGTGAATATTCTCGAGAATATTCACCTGGCAGTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-4429s21c1
Sequence:CCGGTCAGCGCCAGCCTCCTTATTACTCGAGTAATAAGGAGGCTGGCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024408.2-4976s21c1
Sequence:CCGGCACACCAACCTGCGCATTAAGCTCGAGCTTAATGCGCAGGTTGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2859s21c1
Sequence:CCGGAGCGGTGTACCATTGACATTGCTCGAGCAATGTCAATGGTACACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2461s21c1
Sequence:CCGGTGGAGGTCTCAGTGGATATAACTCGAGTTATATCCACTGAGACCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024408.2-7643s1c1
Sequence:CCGGCCACACAACAACATGCAGGTTCTCGAGAACCTGCATGTTGTTGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024408.2-10688s1c1
Sequence:CCGGCCCACTAATAAGTGGTACTATCTCGAGATAGTACCACTTATTAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_024408.2-2736s1c1
Sequence:CCGGGCAAGAATTGTCAGACAGTATCTCGAGATACTGTCTGACAATTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-9642s21c1
Sequence:CCGGTGCGTGTCTGTTGGCATAATACTCGAGTATTATGCCAACAGACACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-6334s21c1
Sequence:CCGGCAAGATCCTGTTAGACCATTTCTCGAGAAATGGTCTAACAGGATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024408.2-6072s1c1
Sequence:CCGGCCAGGATGAATGATGGTACTACTCGAGTAGTACCATCATTCATCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2357s21c1
Sequence:CCGGGTGAATGGTTTCCGCTGTATACTCGAGTATACAGCGGAAACCATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024408
VALIDATED
NOTCH2 MISSION shRNA Lentiviral Transduction Particles
notch 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024408.2-10975s21c1
Sequence:CCGGTACCTCATGATGTCATAATTTCTCGAGAAATTATGACATCATGAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-6747s21c1
Sequence:CCGGCCACATCCTCTCCAATGATTACTCGAGTAATCATTGGAGAGGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2624s21c1
Sequence:CCGGTATAACTGCCAGGTGAATATTCTCGAGAATATTCACCTGGCAGTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-4429s21c1
Sequence:CCGGTCAGCGCCAGCCTCCTTATTACTCGAGTAATAAGGAGGCTGGCGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024408.2-4976s21c1
Sequence:CCGGCACACCAACCTGCGCATTAAGCTCGAGCTTAATGCGCAGGTTGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2859s21c1
Sequence:CCGGAGCGGTGTACCATTGACATTGCTCGAGCAATGTCAATGGTACACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2461s21c1
Sequence:CCGGTGGAGGTCTCAGTGGATATAACTCGAGTTATATCCACTGAGACCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024408.2-7643s1c1
Sequence:CCGGCCACACAACAACATGCAGGTTCTCGAGAACCTGCATGTTGTTGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024408.2-10688s1c1
Sequence:CCGGCCCACTAATAAGTGGTACTATCTCGAGATAGTACCACTTATTAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_024408.2-2736s1c1
Sequence:CCGGGCAAGAATTGTCAGACAGTATCTCGAGATACTGTCTGACAATTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-9642s21c1
Sequence:CCGGTGCGTGTCTGTTGGCATAATACTCGAGTATTATGCCAACAGACACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-6334s21c1
Sequence:CCGGCAAGATCCTGTTAGACCATTTCTCGAGAAATGGTCTAACAGGATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024408.2-6072s1c1
Sequence:CCGGCCAGGATGAATGATGGTACTACTCGAGTAGTACCATCATTCATCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024408.2-2357s21c1
Sequence:CCGGGTGAATGGTTTCCGCTGTATACTCGAGTATACAGCGGAAACCATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)