EMAIL THIS PAGE TO A FRIEND

NOTCH3

notch 3

49 Gene Product Result for
Synonyms: CADASIL CASIL IMF2
UniProtKB ID: Q9UM47, Q9UEB3, Q9UPL3, Q9Y6L8
Gene ID:
Human(4854) Summary: This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
Mouse(18131) notch 3
Rat(56761) notch 3
Zebrafish(58066) notch homolog 3
dog(610439) notch 3
cow(789485) notch 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D5942 DAPT ≥98% (HPLC), solid human, mouse, rat pricing
L1790 L-685,458 >96% (HPLC), solid human, mouse, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB1603 Human Notch-3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000435 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000435 Rosetta Predictions human pricing
NM_020087 Rosetta Predictions rat pricing
NM_008716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101286 predicted 5612
2 SASI_Hs01_00101287 predicted 5026
3 SASI_Hs02_00302544 predicted 4807
4 SASI_Hs01_00101288 predicted 2328
5 SASI_Hs01_00101289 predicted 1464
6 SASI_Hs02_00302545 predicted 2031
7 SASI_Hs02_00302546 predicted 5447
8 SASI_Hs01_00101291 predicted 1466
9 SASI_Hs01_00101292 predicted 5516
10 SASI_Hs01_00101293 predicted 764
11 SASI_Hs01_00101285 predicted 2617
12 SASI_Hs01_00101290 predicted 2616
13 SASI_Hs01_00101294 predicted 3415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106641 predicted 5624
2 SASI_Rn01_00106642 predicted 3394
3 SASI_Rn01_00106643 predicted 5981
4 SASI_Rn01_00106644 predicted 2354
5 SASI_Rn01_00106645 predicted 5632
6 SASI_Rn01_00106646 predicted 752
7 SASI_Rn02_00262494 predicted 2800
8 SASI_Rn01_00106647 predicted 2633
9 SASI_Rn01_00106648 predicted 4544
10 SASI_Rn01_00106649 predicted 5471
11 SASI_Rn01_00106650 predicted 3439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057178 predicted 3403
2 SASI_Mm01_00057180 predicted 5586
3 SASI_Mm01_00057177 predicted 4841
4 SASI_Mm01_00057181 predicted 2597
5 SASI_Mm01_00057182 predicted 5437
6 SASI_Mm01_00057183 predicted 1310
7 SASI_Mm01_00057184 predicted 1404
8 SASI_Mm01_00057185 predicted 3228
9 SASI_Mm01_00057186 predicted 2303
10 SASI_Mm02_00314553 predicted 5152
11 SASI_Mm01_00057179 predicted 4889
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000435
NOTCH3 MISSION shRNA Bacterial Glycerol Stock
notch 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000435.2-1524s21c1
Sequence:CCGGTCTGCAAGGACCGAGTCAATGCTCGAGCATTGACTCGGTCCTTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-1431s1c1
Sequence:CCGGCCAGTTCACCTGTATCTGTATCTCGAGATACAGATACAGGTGAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-5965s1c1
Sequence:CCGGGCCAATAAGGACATGCAGGATCTCGAGATCCTGCATGTCCTTATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-5491s1c1
Sequence:CCGGCCAATGCCAACTGAAGAGGATCTCGAGATCCTCTTCAGTTGGCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-4815s1c1
Sequence:CCGGCTCGGTAGTAATGCTGGAGATCTCGAGATCTCCAGCATTACTACCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-1173s1c1
Sequence:CCGGCTGTGACACAAATCCGGTGAACTCGAGTTCACCGGATTTGTGTCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000435.2-2034s21c1
Sequence:CCGGTTTGTAACGTGGAGATCAATGCTCGAGCATTGATCTCCACGTTACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000435.2-4804s21c1
Sequence:CCGGGGTGATCGGCTCGGTAGTAATCTCGAGATTACTACCGAGCCGATCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000435
NOTCH3 MISSION shRNA shRNA Plasmid DNA
notch 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000435.2-1524s21c1
Sequence:CCGGTCTGCAAGGACCGAGTCAATGCTCGAGCATTGACTCGGTCCTTGCAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000020234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-1431s1c1
Sequence:CCGGCCAGTTCACCTGTATCTGTATCTCGAGATACAGATACAGGTGAACTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000020236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-5965s1c1
Sequence:CCGGGCCAATAAGGACATGCAGGATCTCGAGATCCTGCATGTCCTTATTGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000020238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-5491s1c1
Sequence:CCGGCCAATGCCAACTGAAGAGGATCTCGAGATCCTCTTCAGTTGGCATTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000020235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-4815s1c1
Sequence:CCGGCTCGGTAGTAATGCTGGAGATCTCGAGATCTCCAGCATTACTACCGAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000020237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-1173s1c1
Sequence:CCGGCTGTGACACAAATCCGGTGAACTCGAGTTCACCGGATTTGTGTCACAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000363316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000435.2-2034s21c1
Sequence:CCGGTTTGTAACGTGGAGATCAATGCTCGAGCATTGATCTCCACGTTACAAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000363291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000435.2-4804s21c1
Sequence:CCGGGGTGATCGGCTCGGTAGTAATCTCGAGATTACTACCGAGCCGATCACCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000435
NOTCH3 MISSION shRNA Lentiviral Transduction Particles
notch 3
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000363264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000435.2-1524s21c1
Sequence:CCGGTCTGCAAGGACCGAGTCAATGCTCGAGCATTGACTCGGTCCTTGCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-1431s1c1
Sequence:CCGGCCAGTTCACCTGTATCTGTATCTCGAGATACAGATACAGGTGAACTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-5965s1c1
Sequence:CCGGGCCAATAAGGACATGCAGGATCTCGAGATCCTGCATGTCCTTATTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-5491s1c1
Sequence:CCGGCCAATGCCAACTGAAGAGGATCTCGAGATCCTCTTCAGTTGGCATTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-4815s1c1
Sequence:CCGGCTCGGTAGTAATGCTGGAGATCTCGAGATCTCCAGCATTACTACCGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000435.1-1173s1c1
Sequence:CCGGCTGTGACACAAATCCGGTGAACTCGAGTTCACCGGATTTGTGTCACAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000435.2-2034s21c1
Sequence:CCGGTTTGTAACGTGGAGATCAATGCTCGAGCATTGATCTCCACGTTACAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000435.2-4804s21c1
Sequence:CCGGGGTGATCGGCTCGGTAGTAATCTCGAGATTACTACCGAGCCGATCACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008716
VALIDATED
NOTCH3 MISSION shRNA Bacterial Glycerol Stock
notch 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-1965s21c1
Sequence:CCGGCGTGATGGCATCAACCGTTATCTCGAGATAACGGTTGATGCCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-1393s21c1
Sequence:CCGGCCACGTGTCTTGACCGAATTGCTCGAGCAATTCGGTCAAGACACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-811s21c1
Sequence:CCGGCGTGTGTAGACGGTGTCAATACTCGAGTATTGACACCGTCTACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-4050s21c1
Sequence:CCGGTCACCCTCAGGAGCTACTAACCTCGAGGTTAGTAGCTCCTGAGGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008716.2-7307s21c1
Sequence:CCGGTCTGACAAGAGTGAGTTATTACTCGAGTAATAACTCACTCTTGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008716.1-1285s1c1
Sequence:CCGGGTGTGAATACACAGGGCTCATCTCGAGATGAGCCCTGTGTATTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008716.1-7652s1c1
Sequence:CCGGGCATTCCAGATAAGACGTGTACTCGAGTACACGTCTTATCTGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008716.1-811s1c1
Sequence:CCGGCGTGTGTAGACGGTGTCAATACTCGAGTATTGACACCGTCTACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008716.1-6053s1c1
Sequence:CCGGCCGGGAGATCACAGATCACTTCTCGAGAAGTGATCTGTGATCTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008716.1-3409s1c1
Sequence:CCGGGTGACAGTTGTGAGGATAATACTCGAGTATTATCCTCACAACTGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008716
VALIDATED
NOTCH3 MISSION shRNA shRNA Plasmid DNA
notch 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-1965s21c1
Sequence:CCGGCGTGATGGCATCAACCGTTATCTCGAGATAACGGTTGATGCCATCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000304272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-1393s21c1
Sequence:CCGGCCACGTGTCTTGACCGAATTGCTCGAGCAATTCGGTCAAGACACGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000301344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-811s21c1
Sequence:CCGGCGTGTGTAGACGGTGTCAATACTCGAGTATTGACACCGTCTACACACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000304273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-4050s21c1
Sequence:CCGGTCACCCTCAGGAGCTACTAACCTCGAGGTTAGTAGCTCCTGAGGGTGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000304271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008716.2-7307s21c1
Sequence:CCGGTCTGACAAGAGTGAGTTATTACTCGAGTAATAACTCACTCTTGTCAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000075570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008716.1-1285s1c1
Sequence:CCGGGTGTGAATACACAGGGCTCATCTCGAGATGAGCCCTGTGTATTCACACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000075568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008716.1-7652s1c1
Sequence:CCGGGCATTCCAGATAAGACGTGTACTCGAGTACACGTCTTATCTGGAATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000075569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008716.1-811s1c1
Sequence:CCGGCGTGTGTAGACGGTGTCAATACTCGAGTATTGACACCGTCTACACACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000075571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008716.1-6053s1c1
Sequence:CCGGCCGGGAGATCACAGATCACTTCTCGAGAAGTGATCTGTGATCTCCCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000075572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008716.1-3409s1c1
Sequence:CCGGGTGACAGTTGTGAGGATAATACTCGAGTATTATCCTCACAACTGTCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008716
VALIDATED
NOTCH3 MISSION shRNA Lentiviral Transduction Particles
notch 3
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000310868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-1965s21c1
Sequence:CCGGCGTGATGGCATCAACCGTTATCTCGAGATAACGGTTGATGCCATCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-1393s21c1
Sequence:CCGGCCACGTGTCTTGACCGAATTGCTCGAGCAATTCGGTCAAGACACGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-811s21c1
Sequence:CCGGCGTGTGTAGACGGTGTCAATACTCGAGTATTGACACCGTCTACACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008716.2-4050s21c1
Sequence:CCGGTCACCCTCAGGAGCTACTAACCTCGAGGTTAGTAGCTCCTGAGGGTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008716.2-7307s21c1
Sequence:CCGGTCTGACAAGAGTGAGTTATTACTCGAGTAATAACTCACTCTTGTCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008716.1-1285s1c1
Sequence:CCGGGTGTGAATACACAGGGCTCATCTCGAGATGAGCCCTGTGTATTCACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008716.1-7652s1c1
Sequence:CCGGGCATTCCAGATAAGACGTGTACTCGAGTACACGTCTTATCTGGAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008716.1-811s1c1
Sequence:CCGGCGTGTGTAGACGGTGTCAATACTCGAGTATTGACACCGTCTACACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008716.1-6053s1c1
Sequence:CCGGCCGGGAGATCACAGATCACTTCTCGAGAAGTGATCTGTGATCTCCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008716.1-3409s1c1
Sequence:CCGGGTGACAGTTGTGAGGATAATACTCGAGTATTATCCTCACAACTGTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)