EMAIL THIS PAGE TO A FRIEND

NOTCH4

notch 4

120 Gene Product Result for
Synonyms: INT3 NOTCH3
Gene ID:
Human(4855) Summary: This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. This gene may be associated with susceptibility to schizophrenia in a small portion of cases. An alternative splice variant has been described but its biological nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(18132) notch 4
Rat(406162) notch 4
dog(481726) notch 4
cow(536128) notch 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D5942 DAPT ≥98% (HPLC), solid human, mouse, rat pricing
L1790 L-685,458 >96% (HPLC), solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004557 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU021131 MISSION® esiRNA esiRNA targeting mouse Notch4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004557 Rosetta Predictions human pricing
NM_001002827 Rosetta Predictions rat pricing
NM_010929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052678 predicted 3847
2 SASI_Hs01_00052679 predicted 3074
3 SASI_Hs01_00052680 predicted 2152
4 SASI_Hs02_00337880 predicted 1548
5 SASI_Hs01_00052681 predicted 3019
6 SASI_Hs01_00052682 predicted 1878
7 SASI_Hs01_00052683 predicted 2315
8 SASI_Hs01_00052685 predicted 1895
9 SASI_Hs01_00052686 predicted 3891
10 SASI_Hs01_00052687 predicted 5411
11 SASI_Hs01_00052684 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044137 predicted 206
2 SASI_Rn01_00044138 predicted 6141
3 SASI_Rn01_00044139 predicted 2329
4 SASI_Rn01_00044140 predicted 2004
5 SASI_Rn01_00044141 predicted 718
6 SASI_Rn01_00044142 predicted 4852
7 SASI_Rn01_00044143 predicted 2917
8 SASI_Rn02_00198016 predicted 1905
9 SASI_Rn01_00044145 predicted 5210
10 SASI_Rn01_00044146 predicted 4258
11 SASI_Rn01_00044144 predicted 3233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120947 predicted 4255
2 SASI_Mm02_00319675 predicted 2904
3 SASI_Mm02_00319676 predicted 6135
4 SASI_Mm01_00120949 predicted 6115
5 SASI_Mm01_00120950 predicted 5305
6 SASI_Mm01_00120953 predicted 1880
7 SASI_Mm01_00120954 predicted 4654
8 SASI_Mm01_00120955 predicted 5173
9 SASI_Mm01_00120956 predicted 3892
10 SASI_Mm02_00319677 predicted 1762
11 SASI_Mm01_00120948 predicted 3909
12 SASI_Mm01_00120951 predicted 1518
13 SASI_Mm01_00120952 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010929
VALIDATED
NOTCH4 MISSION shRNA Bacterial Glycerol Stock
notch 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010929.1-6146s1c1
Sequence:CCGGCGGTTGAGATAGACCGTGATTCTCGAGAATCACGGTCTATCTCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-5987s1c1
Sequence:CCGGCTCGGTTGTAAGAAATCTGAACTCGAGTTCAGATTTCTTACAACCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-1864s1c1
Sequence:CCGGGTGAGAAAGAAGTGGACGAATCTCGAGATTCGTCCACTTCTTTCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-4619s1c1
Sequence:CCGGCGAGGACAACATTGGTCTTAACTCGAGTTAAGACCAATGTTGTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-149s1c1
Sequence:CCGGGCCACTCAATTTCCCTGTCATCTCGAGATGACAGGGAAATTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010929.2-1068s21c1
Sequence:CCGGGGGACTGCTCTGAAGATATAGCTCGAGCTATATCTTCAGAGCAGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010929.2-2899s21c1
Sequence:CCGGTGGATTCCAAGGCAAGTTATGCTCGAGCATAACTTGCCTTGGAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010929.2-5312s21c1
Sequence:CCGGGATGTAGGAGCCAGGGATAAACTCGAGTTTATCCCTGGCTCCTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010929.2-1668s21c1
Sequence:CCGGTCTGTGAGGTGGAGGTCAATGCTCGAGCATTGACCTCCACCTCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010929.2-6344s21c1
Sequence:CCGGCACAAGTAGCTGGCAACTATTCTCGAGAATAGTTGCCAGCTACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010929
VALIDATED
NOTCH4 MISSION shRNA shRNA Plasmid DNA
notch 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010929.1-6146s1c1
Sequence:CCGGCGGTTGAGATAGACCGTGATTCTCGAGAATCACGGTCTATCTCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-5987s1c1
Sequence:CCGGCTCGGTTGTAAGAAATCTGAACTCGAGTTCAGATTTCTTACAACCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-1864s1c1
Sequence:CCGGGTGAGAAAGAAGTGGACGAATCTCGAGATTCGTCCACTTCTTTCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-4619s1c1
Sequence:CCGGCGAGGACAACATTGGTCTTAACTCGAGTTAAGACCAATGTTGTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-149s1c1
Sequence:CCGGGCCACTCAATTTCCCTGTCATCTCGAGATGACAGGGAAATTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010929.2-1068s21c1
Sequence:CCGGGGGACTGCTCTGAAGATATAGCTCGAGCTATATCTTCAGAGCAGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010929.2-2899s21c1
Sequence:CCGGTGGATTCCAAGGCAAGTTATGCTCGAGCATAACTTGCCTTGGAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010929.2-5312s21c1
Sequence:CCGGGATGTAGGAGCCAGGGATAAACTCGAGTTTATCCCTGGCTCCTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010929.2-1668s21c1
Sequence:CCGGTCTGTGAGGTGGAGGTCAATGCTCGAGCATTGACCTCCACCTCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010929.2-6344s21c1
Sequence:CCGGCACAAGTAGCTGGCAACTATTCTCGAGAATAGTTGCCAGCTACTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010929
VALIDATED
NOTCH4 MISSION shRNA Lentiviral Transduction Particles
notch 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010929.1-6146s1c1
Sequence:CCGGCGGTTGAGATAGACCGTGATTCTCGAGAATCACGGTCTATCTCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-5987s1c1
Sequence:CCGGCTCGGTTGTAAGAAATCTGAACTCGAGTTCAGATTTCTTACAACCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-1864s1c1
Sequence:CCGGGTGAGAAAGAAGTGGACGAATCTCGAGATTCGTCCACTTCTTTCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-4619s1c1
Sequence:CCGGCGAGGACAACATTGGTCTTAACTCGAGTTAAGACCAATGTTGTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010929.1-149s1c1
Sequence:CCGGGCCACTCAATTTCCCTGTCATCTCGAGATGACAGGGAAATTGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010929.2-1068s21c1
Sequence:CCGGGGGACTGCTCTGAAGATATAGCTCGAGCTATATCTTCAGAGCAGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010929.2-2899s21c1
Sequence:CCGGTGGATTCCAAGGCAAGTTATGCTCGAGCATAACTTGCCTTGGAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010929.2-5312s21c1
Sequence:CCGGGATGTAGGAGCCAGGGATAAACTCGAGTTTATCCCTGGCTCCTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010929.2-1668s21c1
Sequence:CCGGTCTGTGAGGTGGAGGTCAATGCTCGAGCATTGACCTCCACCTCACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010929.2-6344s21c1
Sequence:CCGGCACAAGTAGCTGGCAACTATTCTCGAGAATAGTTGCCAGCTACTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004557
NOTCH4 MISSION shRNA Bacterial Glycerol Stock
notch 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-2047s1c1
Sequence:CCGGGCAGATATGTAAGGACCAGAACTCGAGTTCTGGTCCTTACATATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-5410s1c1
Sequence:CCGGCGATAAAGATGCCCAGGACAACTCGAGTTGTCCTGGGCATCTTTATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-5916s1c1
Sequence:CCGGCTGCGATAATGCGAGGAAGATCTCGAGATCTTCCTCGCATTATCGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-977s1c1
Sequence:CCGGGTCAGCCACCAATGTCAGAATCTCGAGATTCTGACATTGGTGGCTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-1770s1c1
Sequence:CCGGGCACCCGATGTGAGGAGGATACTCGAGTATCCTCCTCACATCGGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004557.3-6402s21c1
Sequence:CCGGGGCAGAGTGGAGTGGAAATACCTCGAGGTATTTCCACTCCACTCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004557.3-3930s21c1
Sequence:CCGGACAACGGGCACTGTGAGAAAGCTCGAGCTTTCTCACAGTGCCCGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004557.3-6325s21c1
Sequence:CCGGGCTCTGGAAAGAGGGTTTAAGCTCGAGCTTAAACCCTCTTTCCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004557
NOTCH4 MISSION shRNA shRNA Plasmid DNA
notch 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-2047s1c1
Sequence:CCGGGCAGATATGTAAGGACCAGAACTCGAGTTCTGGTCCTTACATATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-5410s1c1
Sequence:CCGGCGATAAAGATGCCCAGGACAACTCGAGTTGTCCTGGGCATCTTTATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-5916s1c1
Sequence:CCGGCTGCGATAATGCGAGGAAGATCTCGAGATCTTCCTCGCATTATCGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-977s1c1
Sequence:CCGGGTCAGCCACCAATGTCAGAATCTCGAGATTCTGACATTGGTGGCTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-1770s1c1
Sequence:CCGGGCACCCGATGTGAGGAGGATACTCGAGTATCCTCCTCACATCGGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004557.3-6402s21c1
Sequence:CCGGGGCAGAGTGGAGTGGAAATACCTCGAGGTATTTCCACTCCACTCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004557.3-3930s21c1
Sequence:CCGGACAACGGGCACTGTGAGAAAGCTCGAGCTTTCTCACAGTGCCCGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004557.3-6325s21c1
Sequence:CCGGGCTCTGGAAAGAGGGTTTAAGCTCGAGCTTAAACCCTCTTTCCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004557
NOTCH4 MISSION shRNA Lentiviral Transduction Particles
notch 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-2047s1c1
Sequence:CCGGGCAGATATGTAAGGACCAGAACTCGAGTTCTGGTCCTTACATATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-5410s1c1
Sequence:CCGGCGATAAAGATGCCCAGGACAACTCGAGTTGTCCTGGGCATCTTTATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-5916s1c1
Sequence:CCGGCTGCGATAATGCGAGGAAGATCTCGAGATCTTCCTCGCATTATCGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-977s1c1
Sequence:CCGGGTCAGCCACCAATGTCAGAATCTCGAGATTCTGACATTGGTGGCTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004557.2-1770s1c1
Sequence:CCGGGCACCCGATGTGAGGAGGATACTCGAGTATCCTCCTCACATCGGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004557.3-6402s21c1
Sequence:CCGGGGCAGAGTGGAGTGGAAATACCTCGAGGTATTTCCACTCCACTCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004557.3-3930s21c1
Sequence:CCGGACAACGGGCACTGTGAGAAAGCTCGAGCTTTCTCACAGTGCCCGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004557.3-6325s21c1
Sequence:CCGGGCTCTGGAAAGAGGGTTTAAGCTCGAGCTTAAACCCTCTTTCCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)