EMAIL THIS PAGE TO A FRIEND

NOTO

notochord homeobox

69 Gene Product Result for
UniProtKB ID: A8MTQ0, B4DJ59, B7ZAU5
Gene ID:
Mouse(384452) notochord homolog (Xenopus laevis)
Rat(502857) notochord homeobox
cow(100335771) notochord homeobox
domestic cat(101097885) notochord homeobox
dog(612345) notochord homeobox
sheep(101103888) notochord homeobox
domestic guinea pig(100715792) notochord homeobox
naked mole-rat(101721608) notochord homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001134462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001134462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001134462 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_292889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_292889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_292889 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001719354 Rosetta Predictions human pricing
XM_292889 Rosetta Predictions human pricing
XM_941998 Rosetta Predictions human pricing
XM_001073866 Rosetta Predictions rat pricing
XM_578357 Rosetta Predictions rat pricing
NM_001007472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00429768 predicted 299
2 SASI_Hs02_00429769 predicted 553
3 SASI_Hs02_00429770 predicted 299
4 SASI_Hs02_00429771 predicted 368
5 SASI_Hs02_00429772 predicted 389
6 SASI_Hs02_00429773 predicted 358
7 SASI_Hs02_00429774 predicted 391
8 SASI_Hs02_00429775 predicted 221
9 SASI_Hs02_00429776 predicted 385
10 SASI_Hs02_00429777 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479109 predicted 293
2 SASI_Hs02_00479110 predicted 554
3 SASI_Hs02_00479111 predicted 293
4 SASI_Hs02_00479112 predicted 366
5 SASI_Hs02_00479113 predicted 391
6 SASI_Hs02_00479114 predicted 364
7 SASI_Hs02_00479115 predicted 387
8 SASI_Hs02_00479116 predicted 219
9 SASI_Hs02_00479117 predicted 388
10 SASI_Hs02_00479118 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485193 predicted 301
2 SASI_Hs02_00485194 predicted 551
3 SASI_Hs02_00485195 predicted 299
4 SASI_Hs02_00485196 predicted 365
5 SASI_Hs02_00485197 predicted 395
6 SASI_Hs02_00485198 predicted 359
7 SASI_Hs02_00485199 predicted 388
8 SASI_Hs02_00485200 predicted 220
9 SASI_Hs02_00485201 predicted 385
10 SASI_Hs02_00485202 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344247 predicted 197
2 SASI_Rn02_00344248 predicted 326
3 SASI_Rn02_00344249 predicted 369
4 SASI_Rn02_00344250 predicted 422
5 SASI_Rn02_00344251 predicted 207
6 SASI_Rn02_00344252 predicted 292
7 SASI_Rn02_00344253 predicted 316
8 SASI_Rn02_00344254 predicted 280
9 SASI_Rn02_00344255 predicted 392
10 SASI_Rn02_00344256 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407794 predicted 198
2 SASI_Rn02_00407795 predicted 323
3 SASI_Rn02_00407796 predicted 371
4 SASI_Rn02_00407797 predicted 421
5 SASI_Rn02_00407798 predicted 210
6 SASI_Rn02_00407799 predicted 288
7 SASI_Rn02_00407800 predicted 312
8 SASI_Rn02_00407801 predicted 277
9 SASI_Rn02_00407802 predicted 390
10 SASI_Rn02_00407803 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098490 predicted 511
2 SASI_Mm01_00098491 predicted 376
3 SASI_Mm01_00098492 predicted 502
4 SASI_Mm01_00098493 predicted 413
5 SASI_Mm01_00098494 predicted 423
6 SASI_Mm01_00098495 predicted 341
7 SASI_Mm01_00098496 predicted 536
8 SASI_Mm01_00098497 predicted 431
9 SASI_Mm01_00098498 predicted 513
10 SASI_Mm01_00098499 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134462
NOTO MISSION shRNA Bacterial Glycerol Stock
notochord homeobox
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000442330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134462.1-1271s21c1
Sequence:CCGGAGAATCTGAGCTGTCAAGCAGCTCGAGCTGCTTGACAGCTCAGATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134462
NOTO MISSION shRNA shRNA Plasmid DNA
notochord homeobox
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000442330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134462.1-1271s21c1
Sequence:CCGGAGAATCTGAGCTGTCAAGCAGCTCGAGCTGCTTGACAGCTCAGATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134462
NOTO MISSION shRNA Lentiviral Transduction Particles
notochord homeobox
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000442330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134462.1-1271s21c1
Sequence:CCGGAGAATCTGAGCTGTCAAGCAGCTCGAGCTGCTTGACAGCTCAGATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_292889
NOTO MISSION shRNA Bacterial Glycerol Stock
notochord homeobox
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-505s1c1
Sequence:CCGGGAAGAGTTGGAGAAAGTGTTTCTCGAGAAACACTTTCTCCAACTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-449s1c1
Sequence:CCGGAGGACACTGAGAGACAGCAAACTCGAGTTTGCTGTCTCTCAGTGTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-477s1c1
Sequence:CCGGCCGAACTATGTTTAACTTGGACTCGAGTCCAAGTTAAACATAGTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-576s1c1
Sequence:CCGGGCTCAAACTTACAGAGAACCACTCGAGTGGTTCTCTGTAAGTTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-300s1c1
Sequence:CCGGCGCCTACCTGAGCGTAGGTTTCTCGAGAAACCTACGCTCAGGTAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_292889
NOTO MISSION shRNA shRNA Plasmid DNA
notochord homeobox
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-505s1c1
Sequence:CCGGGAAGAGTTGGAGAAAGTGTTTCTCGAGAAACACTTTCTCCAACTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-449s1c1
Sequence:CCGGAGGACACTGAGAGACAGCAAACTCGAGTTTGCTGTCTCTCAGTGTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-477s1c1
Sequence:CCGGCCGAACTATGTTTAACTTGGACTCGAGTCCAAGTTAAACATAGTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-576s1c1
Sequence:CCGGGCTCAAACTTACAGAGAACCACTCGAGTGGTTCTCTGTAAGTTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-300s1c1
Sequence:CCGGCGCCTACCTGAGCGTAGGTTTCTCGAGAAACCTACGCTCAGGTAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_292889
NOTO MISSION shRNA Lentiviral Transduction Particles
notochord homeobox
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-505s1c1
Sequence:CCGGGAAGAGTTGGAGAAAGTGTTTCTCGAGAAACACTTTCTCCAACTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-449s1c1
Sequence:CCGGAGGACACTGAGAGACAGCAAACTCGAGTTTGCTGTCTCTCAGTGTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-477s1c1
Sequence:CCGGCCGAACTATGTTTAACTTGGACTCGAGTCCAAGTTAAACATAGTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-576s1c1
Sequence:CCGGGCTCAAACTTACAGAGAACCACTCGAGTGGTTCTCTGTAAGTTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292889.2-300s1c1
Sequence:CCGGCGCCTACCTGAGCGTAGGTTTCTCGAGAAACCTACGCTCAGGTAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007472
NOTO MISSION shRNA Bacterial Glycerol Stock
notochord homeobox
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007472.1-801s1c1
Sequence:CCGGCTTTAGTTATATGGGCTAGTTCTCGAGAACTAGCCCATATAACTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-666s1c1
Sequence:CCGGGTGAAGTATCAGAAGCAGCAACTCGAGTTGCTGCTTCTGATACTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-756s1c1
Sequence:CCGGGAAGATGCTGAGTTGGGAATTCTCGAGAATTCCCAACTCAGCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-491s1c1
Sequence:CCGGCGGGACCGAGAGACACACAAACTCGAGTTTGTGTGTCTCTCGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-738s1c1
Sequence:CCGGGATGGCAACATCCAGAGTGAACTCGAGTTCACTCTGGATGTTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007472
NOTO MISSION shRNA shRNA Plasmid DNA
notochord homeobox
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007472.1-801s1c1
Sequence:CCGGCTTTAGTTATATGGGCTAGTTCTCGAGAACTAGCCCATATAACTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-666s1c1
Sequence:CCGGGTGAAGTATCAGAAGCAGCAACTCGAGTTGCTGCTTCTGATACTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-756s1c1
Sequence:CCGGGAAGATGCTGAGTTGGGAATTCTCGAGAATTCCCAACTCAGCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-491s1c1
Sequence:CCGGCGGGACCGAGAGACACACAAACTCGAGTTTGTGTGTCTCTCGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-738s1c1
Sequence:CCGGGATGGCAACATCCAGAGTGAACTCGAGTTCACTCTGGATGTTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007472
NOTO MISSION shRNA Lentiviral Transduction Particles
notochord homeobox
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007472.1-801s1c1
Sequence:CCGGCTTTAGTTATATGGGCTAGTTCTCGAGAACTAGCCCATATAACTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-666s1c1
Sequence:CCGGGTGAAGTATCAGAAGCAGCAACTCGAGTTGCTGCTTCTGATACTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-756s1c1
Sequence:CCGGGAAGATGCTGAGTTGGGAATTCTCGAGAATTCCCAACTCAGCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-491s1c1
Sequence:CCGGCGGGACCGAGAGACACACAAACTCGAGTTTGTGTGTCTCTCGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007472.1-738s1c1
Sequence:CCGGGATGGCAACATCCAGAGTGAACTCGAGTTCACTCTGGATGTTGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)