EMAIL THIS PAGE TO A FRIEND

NOTUM

notum pectinacetylesterase homolog (Drosophila)

72 Gene Product Result for
UniProtKB ID: Q6P988, Q8N410, Q8NI82
Gene ID:
Mouse(77583) notum pectinacetylesterase homolog (Drosophila)
Rat(303743) notum pectinacetylesterase homolog (Drosophila)
fruit fly(39751) CG13076 gene product from transcript CG13076-RA
chicken(417385) notum pectinacetylesterase homolog (Drosophila)
dog(483374) notum pectinacetylesterase homolog (Drosophila)
domestic cat(101090914) notum pectinacetylesterase homolog (Drosophila)
cow(525682) notum pectinacetylesterase homolog (Drosophila)
naked mole-rat(101721669) notum pectinacetylesterase homolog (Drosophila)
domestic guinea pig(100735619) notum pectinacetylesterase homolog (Drosophila)
sheep(101107806) notum pectinacetylesterase homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178493 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU170771 MISSION® esiRNA esiRNA targeting mouse Notum mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178493 Rosetta Predictions human pricing
NM_001013975 Rosetta Predictions rat pricing
NM_175263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089870 predicted 1101
2 SASI_Hs01_00089871 predicted 1098
3 SASI_Hs01_00089872 predicted 1666
4 SASI_Hs01_00089873 predicted 659
5 SASI_Hs01_00089874 predicted 870
6 SASI_Hs01_00089875 predicted 692
7 SASI_Hs01_00089876 predicted 1518
8 SASI_Hs02_00369730 predicted 683
9 SASI_Hs01_00089877 predicted 852
10 SASI_Hs01_00089879 predicted 1088
11 SASI_Hs01_00089878 predicted 1366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201312 predicted 621
2 SASI_Rn01_00070370 predicted 1138
3 SASI_Rn01_00070372 predicted 931
4 SASI_Rn02_00201313 predicted 611
5 SASI_Rn01_00070377 predicted 1037
6 SASI_Rn02_00201314 predicted 1235
7 SASI_Rn02_00201315 predicted 1400
8 SASI_Rn02_00201316 predicted 538
9 SASI_Rn02_00201317 predicted 457
10 SASI_Rn02_00201318 predicted 1654
11 SASI_Rn01_00070371 predicted 767
12 SASI_Rn01_00070373 predicted 572
13 SASI_Rn01_00070374 predicted 829
14 SASI_Rn01_00070375 predicted 484
15 SASI_Rn01_00070376 predicted 700
16 SASI_Rn01_00070378 predicted 917
17 SASI_Rn01_00070379 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345967 predicted 1571
2 SASI_Mm02_00345968 predicted 1481
3 SASI_Mm02_00345969 predicted 444
4 SASI_Mm02_00345970 predicted 472
5 SASI_Mm02_00345971 predicted 283
6 SASI_Mm02_00345972 predicted 628
7 SASI_Mm02_00345973 predicted 1127
8 SASI_Mm02_00345974 predicted 270
9 SASI_Mm02_00345975 predicted 1172
10 SASI_Mm02_00345976 predicted 690
11 SASI_Mm01_00060574 predicted 1171
12 SASI_Mm01_00060575 predicted 1950
13 SASI_Mm01_00060576 predicted 1967
14 SASI_Mm01_00060577 predicted 2455
15 SASI_Mm01_00060578 predicted 2450
16 SASI_Mm01_00060579 predicted 2548
17 SASI_Mm01_00060580 predicted 2625
18 SASI_Mm01_00060581 predicted 2313
19 SASI_Mm01_00060582 predicted 2291
20 SASI_Mm01_00060583 predicted 2581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175263
NOTUM MISSION shRNA Bacterial Glycerol Stock
notum pectinacetylesterase homolog (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2349s1c1
Sequence:CCGGCATGAAGAAGATCACTAAGAACTCGAGTTCTTAGTGATCTTCTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2340s1c1
Sequence:CCGGGCTGCACTCCATGAAGAAGATCTCGAGATCTTCTTCATGGAGTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2283s1c1
Sequence:CCGGCAGAGACCGTACTGCTACTTACTCGAGTAAGTAGCAGTACGGTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2259s1c1
Sequence:CCGGGCAGTTGTTAGGAGACATGTACTCGAGTACATGTCTCCTAACAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2452s1c1
Sequence:CCGGCCAAGTCATCTCACCTAATGTCTCGAGACATTAGGTGAGATGACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175263
NOTUM MISSION shRNA shRNA Plasmid DNA
notum pectinacetylesterase homolog (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2349s1c1
Sequence:CCGGCATGAAGAAGATCACTAAGAACTCGAGTTCTTAGTGATCTTCTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2340s1c1
Sequence:CCGGGCTGCACTCCATGAAGAAGATCTCGAGATCTTCTTCATGGAGTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2283s1c1
Sequence:CCGGCAGAGACCGTACTGCTACTTACTCGAGTAAGTAGCAGTACGGTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2259s1c1
Sequence:CCGGGCAGTTGTTAGGAGACATGTACTCGAGTACATGTCTCCTAACAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2452s1c1
Sequence:CCGGCCAAGTCATCTCACCTAATGTCTCGAGACATTAGGTGAGATGACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175263
NOTUM MISSION shRNA Lentiviral Transduction Particles
notum pectinacetylesterase homolog (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2349s1c1
Sequence:CCGGCATGAAGAAGATCACTAAGAACTCGAGTTCTTAGTGATCTTCTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2340s1c1
Sequence:CCGGGCTGCACTCCATGAAGAAGATCTCGAGATCTTCTTCATGGAGTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2283s1c1
Sequence:CCGGCAGAGACCGTACTGCTACTTACTCGAGTAAGTAGCAGTACGGTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2259s1c1
Sequence:CCGGGCAGTTGTTAGGAGACATGTACTCGAGTACATGTCTCCTAACAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175263.2-2452s1c1
Sequence:CCGGCCAAGTCATCTCACCTAATGTCTCGAGACATTAGGTGAGATGACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178493
NOTUM MISSION shRNA Bacterial Glycerol Stock
notum pectinacetylesterase homolog (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-859s1c1
Sequence:CCGGCAAGTCTGAGAAGAACGAGTACTCGAGTACTCGTTCTTCTCAGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1439s1c1
Sequence:CCGGCTCTCCCATGAGATCATCATCCTCGAGGATGATGATCTCATGGGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178493.3-2022s1c1
Sequence:CCGGGCCAGAAGAGAAGCACTGGATCTCGAGATCCAGTGCTTCTCTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1220s1c1
Sequence:CCGGGAGGAGTGGAACTGCTTCTTTCTCGAGAAAGAAGCAGTTCCACTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-852s1c1
Sequence:CCGGCTTCATCCAAGTCTGAGAAGACTCGAGTCTTCTCAGACTTGGATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-796s1c1
Sequence:CCGGGTGGAACGCAAACATGGTCTTCTCGAGAAGACCATGTTTGCGTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1654s1c1
Sequence:CCGGGCAAGAGATGAACGTGGCCCACTCGAGTGGGCCACGTTCATCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-868s1c1
Sequence:CCGGGAAGAACGAGTACGCCTTCATCTCGAGATGAAGGCGTACTCGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1228s1c1
Sequence:CCGGGAACTGCTTCTTTGGCTACAACTCGAGTTGTAGCCAAAGAAGCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1234s1c1
Sequence:CCGGCTTCTTTGGCTACAAGGTCTACTCGAGTAGACCTTGTAGCCAAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1081s1c1
Sequence:CCGGGTTCCTGGACAACAAGCAGTACTCGAGTACTGCTTGTTGTCCAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178493
NOTUM MISSION shRNA shRNA Plasmid DNA
notum pectinacetylesterase homolog (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-859s1c1
Sequence:CCGGCAAGTCTGAGAAGAACGAGTACTCGAGTACTCGTTCTTCTCAGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1439s1c1
Sequence:CCGGCTCTCCCATGAGATCATCATCCTCGAGGATGATGATCTCATGGGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178493.3-2022s1c1
Sequence:CCGGGCCAGAAGAGAAGCACTGGATCTCGAGATCCAGTGCTTCTCTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1220s1c1
Sequence:CCGGGAGGAGTGGAACTGCTTCTTTCTCGAGAAAGAAGCAGTTCCACTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-852s1c1
Sequence:CCGGCTTCATCCAAGTCTGAGAAGACTCGAGTCTTCTCAGACTTGGATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-796s1c1
Sequence:CCGGGTGGAACGCAAACATGGTCTTCTCGAGAAGACCATGTTTGCGTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1654s1c1
Sequence:CCGGGCAAGAGATGAACGTGGCCCACTCGAGTGGGCCACGTTCATCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-868s1c1
Sequence:CCGGGAAGAACGAGTACGCCTTCATCTCGAGATGAAGGCGTACTCGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1228s1c1
Sequence:CCGGGAACTGCTTCTTTGGCTACAACTCGAGTTGTAGCCAAAGAAGCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1234s1c1
Sequence:CCGGCTTCTTTGGCTACAAGGTCTACTCGAGTAGACCTTGTAGCCAAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1081s1c1
Sequence:CCGGGTTCCTGGACAACAAGCAGTACTCGAGTACTGCTTGTTGTCCAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178493
NOTUM MISSION shRNA Lentiviral Transduction Particles
notum pectinacetylesterase homolog (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-859s1c1
Sequence:CCGGCAAGTCTGAGAAGAACGAGTACTCGAGTACTCGTTCTTCTCAGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1439s1c1
Sequence:CCGGCTCTCCCATGAGATCATCATCCTCGAGGATGATGATCTCATGGGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178493.3-2022s1c1
Sequence:CCGGGCCAGAAGAGAAGCACTGGATCTCGAGATCCAGTGCTTCTCTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1220s1c1
Sequence:CCGGGAGGAGTGGAACTGCTTCTTTCTCGAGAAAGAAGCAGTTCCACTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-852s1c1
Sequence:CCGGCTTCATCCAAGTCTGAGAAGACTCGAGTCTTCTCAGACTTGGATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-796s1c1
Sequence:CCGGGTGGAACGCAAACATGGTCTTCTCGAGAAGACCATGTTTGCGTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1654s1c1
Sequence:CCGGGCAAGAGATGAACGTGGCCCACTCGAGTGGGCCACGTTCATCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-868s1c1
Sequence:CCGGGAAGAACGAGTACGCCTTCATCTCGAGATGAAGGCGTACTCGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1228s1c1
Sequence:CCGGGAACTGCTTCTTTGGCTACAACTCGAGTTGTAGCCAAAGAAGCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1234s1c1
Sequence:CCGGCTTCTTTGGCTACAAGGTCTACTCGAGTAGACCTTGTAGCCAAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178493.3-1081s1c1
Sequence:CCGGGTTCCTGGACAACAAGCAGTACTCGAGTACTGCTTGTTGTCCAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)