EMAIL THIS PAGE TO A FRIEND

NOVA1

neuro-oncological ventral antigen 1

357 Gene Product Result for
Synonyms: Nova-1
UniProtKB ID: P51513, A8K0S4, A8K4Q7, D3DS81, D3DS82, Q6B004
Gene ID:
Human(4857) Summary: This gene encodes a neuron-specific RNA-binding protein, a member of the Nova family of paraneoplastic disease antigens, that is recognized and inhibited by paraneoplastic antibodies. These antibodies are found in the sera of patients with paraneoplastic opsoclonus-ataxia, breast cancer, and small cell lung cancer. Alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(664883) neuro-oncological ventral antigen 1
Rat(298992) neuro-oncological ventral antigen 1
domestic guinea pig(100713069) neuro-oncological ventral antigen 1
sheep(101114392) neuro-oncological ventral antigen 1
Zebrafish(555590) neuro-oncological ventral antigen 1
dog(490632) neuro-oncological ventral antigen 1
cow(533792) neuro-oncological ventral antigen 1
cow(790874) RNA-binding protein Nova-1-like
chicken(423300) neuro-oncological ventral antigen 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006491 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077641 MISSION® esiRNA esiRNA human NOVA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002515 Rosetta Predictions human pricing
NM_006489 Rosetta Predictions human pricing
NM_006491 Rosetta Predictions human pricing
XM_001058589 Rosetta Predictions rat pricing
XM_001075031 Rosetta Predictions rat pricing
XM_001075054 Rosetta Predictions rat pricing
XM_234098 Rosetta Predictions rat pricing
XM_001472258 Rosetta Predictions mouse pricing
XM_001472291 Rosetta Predictions mouse pricing
XM_001472321 Rosetta Predictions mouse pricing
XM_912494 Rosetta Predictions mouse pricing
XM_922411 Rosetta Predictions mouse pricing
XM_973643 Rosetta Predictions mouse pricing
XM_973686 Rosetta Predictions mouse pricing
XM_973725 Rosetta Predictions mouse pricing
XM_973756 Rosetta Predictions mouse pricing
XM_973791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091266 predicted 488
2 SASI_Hs01_00091267 predicted 522
3 SASI_Hs01_00091268 predicted 489
4 SASI_Hs01_00091269 predicted 521
5 SASI_Hs01_00091270 predicted 522
6 SASI_Hs01_00091271 predicted 488
7 SASI_Hs01_00091272 predicted 523
8 SASI_Hs01_00091273 predicted 488
9 SASI_Hs01_00091274 predicted 470
10 SASI_Hs02_00333980 predicted 473
11 SASI_Hs01_00091265 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231222 predicted 479
2 SASI_Hs01_00231223 predicted 523
3 SASI_Hs01_00231224 predicted 485
4 SASI_Hs01_00231225 predicted 523
5 SASI_Hs01_00231226 predicted 527
6 SASI_Hs01_00231227 predicted 482
7 SASI_Hs01_00231228 predicted 514
8 SASI_Hs01_00231229 predicted 486
9 SASI_Hs01_00231230 predicted 471
10 SASI_Hs02_00341684 predicted 466
11 SASI_Hs01_00231221 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096225 predicted 479
2 SASI_Hs01_00096226 predicted 517
3 SASI_Hs01_00096227 predicted 489
4 SASI_Hs01_00096228 predicted 526
5 SASI_Hs01_00096229 predicted 528
6 SASI_Hs01_00096230 predicted 483
7 SASI_Hs01_00096231 predicted 518
8 SASI_Hs01_00096232 predicted 483
9 SASI_Hs01_00096233 predicted 466
10 SASI_Hs02_00341685 predicted 471
11 SASI_Hs01_00096224 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290244 predicted 1453
2 SASI_Rn02_00290245 predicted 1280
3 SASI_Rn02_00290246 predicted 995
4 SASI_Rn02_00290247 predicted 1271
5 SASI_Rn02_00290248 predicted 305
6 SASI_Rn02_00290249 predicted 436
7 SASI_Rn02_00290250 predicted 679
8 SASI_Rn02_00290251 predicted 1515
9 SASI_Rn02_00290252 predicted 505
10 SASI_Rn02_00290253 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348171 predicted 1528
2 SASI_Rn02_00348172 predicted 421
3 SASI_Rn02_00348173 predicted 1352
4 SASI_Rn02_00348174 predicted 1073
5 SASI_Rn02_00348175 predicted 508
6 SASI_Rn02_00348176 predicted 1344
7 SASI_Rn02_00348177 predicted 309
8 SASI_Rn02_00348178 predicted 747
9 SASI_Rn02_00348179 predicted 1587
10 SASI_Rn02_00348180 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348261 predicted 1452
2 SASI_Rn02_00348262 predicted 1282
3 SASI_Rn02_00348263 predicted 999
4 SASI_Rn02_00348264 predicted 1267
5 SASI_Rn02_00348265 predicted 309
6 SASI_Rn02_00348266 predicted 433
7 SASI_Rn02_00348267 predicted 680
8 SASI_Rn02_00348268 predicted 1511
9 SASI_Rn02_00348269 predicted 505
10 SASI_Rn02_00348270 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388274 predicted 1524
2 SASI_Rn02_00388275 predicted 419
3 SASI_Rn02_00388276 predicted 1351
4 SASI_Rn02_00388277 predicted 1069
5 SASI_Rn02_00388278 predicted 510
6 SASI_Rn02_00388279 predicted 1341
7 SASI_Rn02_00388280 predicted 312
8 SASI_Rn02_00388281 predicted 746
9 SASI_Rn02_00388282 predicted 1579
10 SASI_Rn02_00388283 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00360330 predicted 1084
2 SASI_Mm02_00360331 predicted 515
3 SASI_Mm02_00360332 predicted 1262
4 SASI_Mm02_00360333 predicted 865
5 SASI_Mm02_00360334 predicted 1348
6 SASI_Mm02_00360335 predicted 1264
7 SASI_Mm02_00360336 predicted 1593
8 SASI_Mm02_00360337 predicted 590
9 SASI_Mm02_00360338 predicted 971
10 SASI_Mm02_00360339 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00360547 predicted 413
2 SASI_Mm02_00360548 predicted 994
3 SASI_Mm02_00360549 predicted 1179
4 SASI_Mm02_00360550 predicted 780
5 SASI_Mm02_00360551 predicted 1268
6 SASI_Mm02_00360552 predicted 1180
7 SASI_Mm02_00360553 predicted 1512
8 SASI_Mm02_00360554 predicted 508
9 SASI_Mm02_00360555 predicted 889
10 SASI_Mm02_00360556 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00360725 predicted 336
2 SASI_Mm02_00360726 predicted 428
3 SASI_Mm02_00360727 predicted 335
4 SASI_Mm02_00360728 predicted 255
5 SASI_Mm02_00360729 predicted 420
6 SASI_Mm02_00360730 predicted 431
7 SASI_Mm02_00360731 predicted 398
8 SASI_Mm02_00360732 predicted 433
9 SASI_Mm02_00360733 predicted 333
10 SASI_Mm02_00360734 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437131 predicted 1086
2 SASI_Mm02_00437132 predicted 517
3 SASI_Mm02_00437133 predicted 1266
4 SASI_Mm02_00437134 predicted 869
5 SASI_Mm02_00437135 predicted 1352
6 SASI_Mm02_00437136 predicted 1267
7 SASI_Mm02_00437137 predicted 1596
8 SASI_Mm02_00437138 predicted 588
9 SASI_Mm02_00437139 predicted 968
10 SASI_Mm02_00437140 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_922411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443406 predicted 414
2 SASI_Mm02_00443407 predicted 1001
3 SASI_Mm02_00443408 predicted 1183
4 SASI_Mm02_00443409 predicted 781
5 SASI_Mm02_00443410 predicted 1267
6 SASI_Mm02_00443411 predicted 1177
7 SASI_Mm02_00443412 predicted 1511
8 SASI_Mm02_00443413 predicted 506
9 SASI_Mm02_00443414 predicted 886
10 SASI_Mm02_00443415 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241567 predicted 345
2 SASI_Mm01_00241568 predicted 350
3 SASI_Mm01_00241569 predicted 333
4 SASI_Mm01_00241570 predicted 346
5 SASI_Mm01_00241571 predicted 327
6 SASI_Mm01_00241572 predicted 338
7 SASI_Mm01_00241573 predicted 339
8 SASI_Mm01_00241574 predicted 351
9 SASI_Mm01_00241575 predicted 153
10 SASI_Mm01_00241576 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228249 predicted 350
2 SASI_Mm01_00228250 predicted 819
3 SASI_Mm01_00228251 predicted 809
4 SASI_Mm01_00228252 predicted 536
5 SASI_Mm01_00228253 predicted 791
6 SASI_Mm01_00228254 predicted 617
7 SASI_Mm01_00228255 predicted 500
8 SASI_Mm01_00228256 predicted 667
9 SASI_Mm01_00228257 predicted 550
10 SASI_Mm01_00228258 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208308 predicted 1084
2 SASI_Mm01_00208309 predicted 529
3 SASI_Mm01_00208310 predicted 1268
4 SASI_Mm01_00208311 predicted 871
5 SASI_Mm01_00208312 predicted 1360
6 SASI_Mm01_00208313 predicted 1273
7 SASI_Mm01_00208314 predicted 602
8 SASI_Mm01_00208315 predicted 979
9 SASI_Mm01_00208316 predicted 1256
10 SASI_Mm01_00208317 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254158 predicted 434
2 SASI_Mm01_00254159 predicted 1019
3 SASI_Mm01_00254160 predicted 1203
4 SASI_Mm01_00254161 predicted 797
5 SASI_Mm01_00254162 predicted 1284
6 SASI_Mm01_00254163 predicted 1202
7 SASI_Mm01_00254164 predicted 1528
8 SASI_Mm01_00254165 predicted 532
9 SASI_Mm01_00254166 predicted 906
10 SASI_Mm01_00254167 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282353 predicted 420
2 SASI_Mm01_00282354 predicted 999
3 SASI_Mm01_00282355 predicted 1188
4 SASI_Mm01_00282356 predicted 793
5 SASI_Mm01_00282357 predicted 1277
6 SASI_Mm01_00282358 predicted 1179
7 SASI_Mm01_00282359 predicted 1513
8 SASI_Mm01_00282360 predicted 512
9 SASI_Mm01_00282361 predicted 889
10 SASI_Mm01_00282362 predicted 1172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006491
VALIDATED
NOVA1 MISSION shRNA Bacterial Glycerol Stock
neuro-oncological ventral antigen 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-1040s21c1
Sequence:CCGGCTTGTCAATAGTCCTGATTAACTCGAGTTAATCAGGACTATTGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_006491.x-532s1c1
Sequence:CCGGACCAAGTCCTCTCCATCTGATCTCGAGATCAGATGGAGAGGACTTGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006491.x-352s1c1
Sequence:CCGGCGAGTGTGCTTGATCCAGGGACTCGAGTCCCTGGATCAAGCACACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006491.x-227s1c1
Sequence:CCGGTACCTAGTTATGCTGCTGGATCTCGAGATCCAGCAGCATAACTAGGTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006491.x-475s1c1
Sequence:CCGGCAGACCACCGTTAATCCAGATCTCGAGATCTGGATTAACGGTGGTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006491.x-247s1c1
Sequence:CCGGTCTATAATTGGGAAGGGAGGACTCGAGTCCTCCCTTCCCAATTATAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-790s21c1
Sequence:CCGGACCAAGTCCTCTCCATCTGATCTCGAGATCAGATGGAGAGGACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-827s21c1
Sequence:CCGGGAGCTAATCAGAAGCATAATACTCGAGTATTATGCTTCTGATTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-733s21c1
Sequence:CCGGCAGACCACCGTTAATCCAGATCTCGAGATCTGGATTAACGGTGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-610s21c1
Sequence:CCGGCGAGTGTGCTTGATCCAGGGACTCGAGTCCCTGGATCAAGCACACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006491
VALIDATED
NOVA1 MISSION shRNA shRNA Plasmid DNA
neuro-oncological ventral antigen 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-1040s21c1
Sequence:CCGGCTTGTCAATAGTCCTGATTAACTCGAGTTAATCAGGACTATTGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_006491.x-532s1c1
Sequence:CCGGACCAAGTCCTCTCCATCTGATCTCGAGATCAGATGGAGAGGACTTGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006491.x-352s1c1
Sequence:CCGGCGAGTGTGCTTGATCCAGGGACTCGAGTCCCTGGATCAAGCACACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006491.x-227s1c1
Sequence:CCGGTACCTAGTTATGCTGCTGGATCTCGAGATCCAGCAGCATAACTAGGTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006491.x-475s1c1
Sequence:CCGGCAGACCACCGTTAATCCAGATCTCGAGATCTGGATTAACGGTGGTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006491.x-247s1c1
Sequence:CCGGTCTATAATTGGGAAGGGAGGACTCGAGTCCTCCCTTCCCAATTATAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-790s21c1
Sequence:CCGGACCAAGTCCTCTCCATCTGATCTCGAGATCAGATGGAGAGGACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-827s21c1
Sequence:CCGGGAGCTAATCAGAAGCATAATACTCGAGTATTATGCTTCTGATTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-733s21c1
Sequence:CCGGCAGACCACCGTTAATCCAGATCTCGAGATCTGGATTAACGGTGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-610s21c1
Sequence:CCGGCGAGTGTGCTTGATCCAGGGACTCGAGTCCCTGGATCAAGCACACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006491
VALIDATED
NOVA1 MISSION shRNA Lentiviral Transduction Particles
neuro-oncological ventral antigen 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-1040s21c1
Sequence:CCGGCTTGTCAATAGTCCTGATTAACTCGAGTTAATCAGGACTATTGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_006491.x-532s1c1
Sequence:CCGGACCAAGTCCTCTCCATCTGATCTCGAGATCAGATGGAGAGGACTTGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006491.x-352s1c1
Sequence:CCGGCGAGTGTGCTTGATCCAGGGACTCGAGTCCCTGGATCAAGCACACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006491.x-227s1c1
Sequence:CCGGTACCTAGTTATGCTGCTGGATCTCGAGATCCAGCAGCATAACTAGGTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006491.x-475s1c1
Sequence:CCGGCAGACCACCGTTAATCCAGATCTCGAGATCTGGATTAACGGTGGTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006491.x-247s1c1
Sequence:CCGGTCTATAATTGGGAAGGGAGGACTCGAGTCCTCCCTTCCCAATTATAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-790s21c1
Sequence:CCGGACCAAGTCCTCTCCATCTGATCTCGAGATCAGATGGAGAGGACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-827s21c1
Sequence:CCGGGAGCTAATCAGAAGCATAATACTCGAGTATTATGCTTCTGATTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-733s21c1
Sequence:CCGGCAGACCACCGTTAATCCAGATCTCGAGATCTGGATTAACGGTGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006491.2-610s21c1
Sequence:CCGGCGAGTGTGCTTGATCCAGGGACTCGAGTCCCTGGATCAAGCACACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)