EMAIL THIS PAGE TO A FRIEND

NOVA2

neuro-oncological ventral antigen 2

68 Gene Product Result for
Synonyms: ANOVA NOVA3
UniProtKB ID: Q9UNW9, O43267, Q9UEA1
Gene ID:
Mouse(384569) neuro-oncological ventral antigen 2
Rat(292681) neuro-oncological ventral antigen 2
Zebrafish(553201) neuro-oncological ventral antigen 2
cow(537783) neuro-oncological ventral antigen 2
domestic cat(101080672) neuro-oncological ventral antigen 2
dog(612213) neuro-oncological ventral antigen 2
sheep(101120187) neuro-oncological ventral antigen 2
domestic guinea pig(100724354) neuro-oncological ventral antigen 2
naked mole-rat(101700992) neuro-oncological ventral antigen 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40399 Anti-NOVA2 (AB1) antibody produced in rabbit IgG fraction of antiserum guinea pig, bovine, rabbit, human, mouse, rat, zebrafish, canine
western blot pricing
AV40400 Anti-NOVA2 (AB2) antibody produced in rabbit IgG fraction of antiserum guinea pig, rabbit, zebrafish, mouse, horse, human, rat, canine,
western blot pricing
HPA045607 Anti-NOVA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002516 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002516 Rosetta Predictions human pricing
XM_001075246 Rosetta Predictions rat pricing
XM_214825 Rosetta Predictions rat pricing
NM_001029877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220812 predicted 349
2 SASI_Hs01_00220813 predicted 345
3 SASI_Hs01_00220814 predicted 670
4 SASI_Hs01_00220815 predicted 315
5 SASI_Hs01_00220816 predicted 347
6 SASI_Hs01_00220817 predicted 353
7 SASI_Hs01_00220818 predicted 335
8 SASI_Hs01_00220819 predicted 326
9 SASI_Hs01_00220820 predicted 318
10 SASI_Hs01_00220821 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348952 predicted 428
2 SASI_Rn02_00348953 predicted 532
3 SASI_Rn02_00348954 predicted 536
4 SASI_Rn02_00348955 predicted 730
5 SASI_Rn02_00348956 predicted 1363
6 SASI_Rn02_00348957 predicted 1201
7 SASI_Rn02_00348958 predicted 500
8 SASI_Rn02_00348959 predicted 507
9 SASI_Rn02_00348960 predicted 684
10 SASI_Rn02_00348961 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160678 predicted 308
2 SASI_Rn01_00160679 predicted 302
3 SASI_Rn01_00160680 predicted 213
4 SASI_Rn01_00160681 predicted 425
5 SASI_Rn01_00160682 predicted 495
6 SASI_Rn01_00160683 predicted 824
7 SASI_Rn01_00160684 predicted 604
8 SASI_Rn01_00160685 predicted 625
9 SASI_Rn01_00160686 predicted 216
10 SASI_Rn01_00160687 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094763 predicted 690
2 SASI_Mm01_00094764 predicted 579
3 SASI_Mm01_00094765 predicted 582
4 SASI_Mm01_00094766 predicted 596
5 SASI_Mm01_00094767 predicted 700
6 SASI_Mm01_00094768 predicted 720
7 SASI_Mm01_00094769 predicted 696
8 SASI_Mm01_00094770 predicted 693
9 SASI_Mm01_00094771 predicted 694
10 SASI_Mm01_00094772 predicted 725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029877
NOVA2 MISSION shRNA Bacterial Glycerol Stock
neuro-oncological ventral antigen 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029877.1-1781s1c1
Sequence:CCGGCCGCTCCTCTTCCCTCCTCTTCTCGAGAAGAGGAGGGAAGAGGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-1730s1c1
Sequence:CCGGCAAACCCACAGAAAGTGGGATCTCGAGATCCCACTTTCTGTGGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-556s1c1
Sequence:CCGGGTCCACAGCTTTATCGCAGAACTCGAGTTCTGCGATAAAGCTGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-403s1c1
Sequence:CCGGGCCGGCTCAATCATCGGCAAACTCGAGTTTGCCGATGATTGAGCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-500s1c1
Sequence:CCGGCAGGAACTACAGAACGGGTATCTCGAGATACCCGTTCTGTAGTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029877
NOVA2 MISSION shRNA shRNA Plasmid DNA
neuro-oncological ventral antigen 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029877.1-1781s1c1
Sequence:CCGGCCGCTCCTCTTCCCTCCTCTTCTCGAGAAGAGGAGGGAAGAGGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-1730s1c1
Sequence:CCGGCAAACCCACAGAAAGTGGGATCTCGAGATCCCACTTTCTGTGGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-556s1c1
Sequence:CCGGGTCCACAGCTTTATCGCAGAACTCGAGTTCTGCGATAAAGCTGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-403s1c1
Sequence:CCGGGCCGGCTCAATCATCGGCAAACTCGAGTTTGCCGATGATTGAGCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-500s1c1
Sequence:CCGGCAGGAACTACAGAACGGGTATCTCGAGATACCCGTTCTGTAGTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029877
NOVA2 MISSION shRNA Lentiviral Transduction Particles
neuro-oncological ventral antigen 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029877.1-1781s1c1
Sequence:CCGGCCGCTCCTCTTCCCTCCTCTTCTCGAGAAGAGGAGGGAAGAGGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-1730s1c1
Sequence:CCGGCAAACCCACAGAAAGTGGGATCTCGAGATCCCACTTTCTGTGGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-556s1c1
Sequence:CCGGGTCCACAGCTTTATCGCAGAACTCGAGTTCTGCGATAAAGCTGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-403s1c1
Sequence:CCGGGCCGGCTCAATCATCGGCAAACTCGAGTTTGCCGATGATTGAGCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029877.1-500s1c1
Sequence:CCGGCAGGAACTACAGAACGGGTATCTCGAGATACCCGTTCTGTAGTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002516
NOVA2 MISSION shRNA Bacterial Glycerol Stock
neuro-oncological ventral antigen 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002516.1-1675s1c1
Sequence:CCGGCTGGTAGTCATAGGCAGGATTCTCGAGAATCCTGCCTATGACTACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-1452s1c1
Sequence:CCGGCGCTCAATACCTCATCAGTCACTCGAGTGACTGATGAGGTATTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-675s1c1
Sequence:CCGGCCTCAACATCAGCTACGCCAACTCGAGTTGGCGTAGCTGATGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-333s1c1
Sequence:CCGGGCACAGCTTTATTGCCGAGAACTCGAGTTCTCGGCAATAAAGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-357s1c1
Sequence:CCGGCCGAGAAATCCCACAAGCGATCTCGAGATCGCTTGTGGGATTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002516.2-504s21c1
Sequence:CCGGGGTGAAAGCCGTGATGGAACACTCGAGTGTTCCATCACGGCTTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002516.2-895s21c1
Sequence:CCGGCTTAACACGCTGGCAAGTTACCTCGAGGTAACTTGCCAGCGTGTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002516.2-285s21c1
Sequence:CCGGAGAGCGGGTATGCCTAGTACACTCGAGTGTACTAGGCATACCCGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002516
NOVA2 MISSION shRNA shRNA Plasmid DNA
neuro-oncological ventral antigen 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002516.1-1675s1c1
Sequence:CCGGCTGGTAGTCATAGGCAGGATTCTCGAGAATCCTGCCTATGACTACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-1452s1c1
Sequence:CCGGCGCTCAATACCTCATCAGTCACTCGAGTGACTGATGAGGTATTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-675s1c1
Sequence:CCGGCCTCAACATCAGCTACGCCAACTCGAGTTGGCGTAGCTGATGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-333s1c1
Sequence:CCGGGCACAGCTTTATTGCCGAGAACTCGAGTTCTCGGCAATAAAGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-357s1c1
Sequence:CCGGCCGAGAAATCCCACAAGCGATCTCGAGATCGCTTGTGGGATTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002516.2-504s21c1
Sequence:CCGGGGTGAAAGCCGTGATGGAACACTCGAGTGTTCCATCACGGCTTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002516.2-895s21c1
Sequence:CCGGCTTAACACGCTGGCAAGTTACCTCGAGGTAACTTGCCAGCGTGTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002516.2-285s21c1
Sequence:CCGGAGAGCGGGTATGCCTAGTACACTCGAGTGTACTAGGCATACCCGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002516
NOVA2 MISSION shRNA Lentiviral Transduction Particles
neuro-oncological ventral antigen 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002516.1-1675s1c1
Sequence:CCGGCTGGTAGTCATAGGCAGGATTCTCGAGAATCCTGCCTATGACTACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-1452s1c1
Sequence:CCGGCGCTCAATACCTCATCAGTCACTCGAGTGACTGATGAGGTATTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-675s1c1
Sequence:CCGGCCTCAACATCAGCTACGCCAACTCGAGTTGGCGTAGCTGATGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-333s1c1
Sequence:CCGGGCACAGCTTTATTGCCGAGAACTCGAGTTCTCGGCAATAAAGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002516.1-357s1c1
Sequence:CCGGCCGAGAAATCCCACAAGCGATCTCGAGATCGCTTGTGGGATTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002516.2-504s21c1
Sequence:CCGGGGTGAAAGCCGTGATGGAACACTCGAGTGTTCCATCACGGCTTTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002516.2-895s21c1
Sequence:CCGGCTTAACACGCTGGCAAGTTACCTCGAGGTAACTTGCCAGCGTGTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002516.2-285s21c1
Sequence:CCGGAGAGCGGGTATGCCTAGTACACTCGAGTGTACTAGGCATACCCGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)