EMAIL THIS PAGE TO A FRIEND

NOX3

NADPH oxidase 3

58 Gene Product Result for
Synonyms: GP91-3 MOX-2
UniProtKB ID: Q9HBY0, Q9HBJ9
Gene ID:
Human(50508) Summary: This gene encodes a member of the NOX family of NADPH oxidases. These enzymes have the capacity to generate superoxide and other reactive oxygen species (ROS) and transport electrons across the plasma membrane. The ROS generated by family members have been implicated in numerous biological functions including host defense, posttranlational processing of proteins, cellular signaling, regulation of gene expression, and cell differentiation. The protein encoded by this gene is expressed predominantly in the inner ear and is involved in the biogenesis of otoconia/otolith, which are crystalline structures of the inner ear involved in the perception of gravity.[provided by RefSeq, May 2009]
Mouse(224480) NADPH oxidase 3
Rat(292279) NADPH oxidase 3
naked mole-rat(101707045) NADPH oxidase 3
Domestic Rabbit(100358363) NADPH oxidase 3
sheep(101106694) NADPH oxidase 3
chicken(428609) NADPH oxidase 3
Horse(100061382) NADPH oxidase 3
cow(526999) NADPH oxidase 3
domestic cat(101090520) NADPH oxidase 3
dog(484046) NADPH oxidase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015718 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051651 MISSION® esiRNA esiRNA human NOX3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015718 Rosetta Predictions human pricing
NM_001004216 Rosetta Predictions rat pricing
XM_579131 Rosetta Predictions rat pricing
NM_198958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034049 predicted 919
2 SASI_Hs01_00034050 predicted 456
3 SASI_Hs01_00034051 predicted 301
4 SASI_Hs01_00034052 predicted 1599
5 SASI_Hs01_00034053 predicted 648
6 SASI_Hs01_00034054 predicted 520
7 SASI_Hs01_00034056 predicted 218
8 SASI_Hs01_00034057 predicted 431
9 SASI_Hs01_00034058 predicted 1796
10 SASI_Hs02_00348404 predicted 1081
11 SASI_Hs01_00034055 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037910 predicted 1442
2 SASI_Rn01_00037911 predicted 567
3 SASI_Rn01_00037912 predicted 590
4 SASI_Rn01_00037913 predicted 322
5 SASI_Rn01_00037914 predicted 832
6 SASI_Rn01_00037915 predicted 1337
7 SASI_Rn01_00037916 predicted 1204
8 SASI_Rn01_00037917 predicted 516
9 SASI_Rn01_00037918 predicted 336
10 SASI_Rn01_00037919 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130674 predicted 1447
2 SASI_Rn01_00130675 predicted 574
3 SASI_Rn01_00130676 predicted 595
4 SASI_Rn01_00130677 predicted 331
5 SASI_Rn01_00130678 predicted 834
6 SASI_Rn01_00130679 predicted 1347
7 SASI_Rn01_00130680 predicted 1210
8 SASI_Rn01_00130681 predicted 518
9 SASI_Rn01_00130682 predicted 341
10 SASI_Rn01_00130683 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092066 predicted 1551
2 SASI_Mm01_00092067 predicted 1137
3 SASI_Mm01_00092068 predicted 1265
4 SASI_Mm01_00092069 predicted 577
5 SASI_Mm01_00092070 predicted 386
6 SASI_Mm01_00092071 predicted 898
7 SASI_Mm01_00092072 predicted 1149
8 SASI_Mm02_00351244 predicted 1561
9 SASI_Mm01_00092073 predicted 300
10 SASI_Mm01_00092074 predicted 633
11 SASI_Mm01_00092075 predicted 1559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198958
NOX3 MISSION shRNA Bacterial Glycerol Stock
NADPH oxidase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-228s21c1
Sequence:CCGGATCTGCCGTGTGCCTGAATTTCTCGAGAAATTCAGGCACACGGCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-819s21c1
Sequence:CCGGCTTATGCCCTGTACCTCAATTCTCGAGAATTGAGGTACAGGGCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-384s21c1
Sequence:CCGGGATAGCTGTCAATTCAGTTATCTCGAGATAACTGAATTGACAGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-1131s21c1
Sequence:CCGGAGACTGGACAGAGGCGTTATTCTCGAGAATAACGCCTCTGTCCAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-131s1c1
Sequence:CCGGCCTATCTGTTTATTGACACATCTCGAGATGTGTCAATAAACAGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-421s21c1
Sequence:CCGGTTGTTCAACCTGGAGCGTTATCTCGAGATAACGCTCCAGGTTGAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-1512s1c1
Sequence:CCGGCCAGGCAATTCACATAGCTTTCTCGAGAAAGCTATGTGAATTGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-975s1c1
Sequence:CCGGCCTGGAACTTCACATGAAGAACTCGAGTTCTTCATGTGAAGTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-533s1c1
Sequence:CCGGGCACCTTTGATATGGGCACAACTCGAGTTGTGCCCATATCAAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-1465s1c1
Sequence:CCGGGCTCATTTACTGAGCTACCATCTCGAGATGGTAGCTCAGTAAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198958
NOX3 MISSION shRNA shRNA Plasmid DNA
NADPH oxidase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-228s21c1
Sequence:CCGGATCTGCCGTGTGCCTGAATTTCTCGAGAAATTCAGGCACACGGCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-819s21c1
Sequence:CCGGCTTATGCCCTGTACCTCAATTCTCGAGAATTGAGGTACAGGGCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-384s21c1
Sequence:CCGGGATAGCTGTCAATTCAGTTATCTCGAGATAACTGAATTGACAGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-1131s21c1
Sequence:CCGGAGACTGGACAGAGGCGTTATTCTCGAGAATAACGCCTCTGTCCAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-131s1c1
Sequence:CCGGCCTATCTGTTTATTGACACATCTCGAGATGTGTCAATAAACAGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-421s21c1
Sequence:CCGGTTGTTCAACCTGGAGCGTTATCTCGAGATAACGCTCCAGGTTGAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-1512s1c1
Sequence:CCGGCCAGGCAATTCACATAGCTTTCTCGAGAAAGCTATGTGAATTGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-975s1c1
Sequence:CCGGCCTGGAACTTCACATGAAGAACTCGAGTTCTTCATGTGAAGTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-533s1c1
Sequence:CCGGGCACCTTTGATATGGGCACAACTCGAGTTGTGCCCATATCAAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-1465s1c1
Sequence:CCGGGCTCATTTACTGAGCTACCATCTCGAGATGGTAGCTCAGTAAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198958
NOX3 MISSION shRNA Lentiviral Transduction Particles
NADPH oxidase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-228s21c1
Sequence:CCGGATCTGCCGTGTGCCTGAATTTCTCGAGAAATTCAGGCACACGGCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-819s21c1
Sequence:CCGGCTTATGCCCTGTACCTCAATTCTCGAGAATTGAGGTACAGGGCATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-384s21c1
Sequence:CCGGGATAGCTGTCAATTCAGTTATCTCGAGATAACTGAATTGACAGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-1131s21c1
Sequence:CCGGAGACTGGACAGAGGCGTTATTCTCGAGAATAACGCCTCTGTCCAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-131s1c1
Sequence:CCGGCCTATCTGTTTATTGACACATCTCGAGATGTGTCAATAAACAGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198958.2-421s21c1
Sequence:CCGGTTGTTCAACCTGGAGCGTTATCTCGAGATAACGCTCCAGGTTGAACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-1512s1c1
Sequence:CCGGCCAGGCAATTCACATAGCTTTCTCGAGAAAGCTATGTGAATTGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-975s1c1
Sequence:CCGGCCTGGAACTTCACATGAAGAACTCGAGTTCTTCATGTGAAGTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-533s1c1
Sequence:CCGGGCACCTTTGATATGGGCACAACTCGAGTTGTGCCCATATCAAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198958.1-1465s1c1
Sequence:CCGGGCTCATTTACTGAGCTACCATCTCGAGATGGTAGCTCAGTAAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015718
NOX3 MISSION shRNA Bacterial Glycerol Stock
NADPH oxidase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015718.2-316s21c1
Sequence:CCAGTGTCAGTCGAAACCTTATTTCCTCGAGGAAATAAGGTTTCGACTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015718.2-1511s21c1
Sequence:CCGGCACTTTCTGAGTTATCATATACTCGAGTATATGATAACTCAGAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015718.2-1594s21c1
Sequence:CCGGTGACGTGATTACAGGCTTAAACTCGAGTTTAAGCCTGTAATCACGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-584s1c1
Sequence:CCGGCCCACAAACACAACCACTGAACTCGAGTTCAGTGGTTGTGTTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-458s1c1
Sequence:CCGGGCGCATTTCTTCAACCTGGAACTCGAGTTCCAGGTTGAAGAAATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-138s1c1
Sequence:CCGGCCACCATATTAGTACTCTCATCTCGAGATGAGAGTACTAATATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-1636s1c1
Sequence:CCGGGCCCAACTGGAACAATGAGTTCTCGAGAACTCATTGTTCCAGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-1346s1c1
Sequence:CCGGGCTGCTCTTCTGAAATCTATACTCGAGTATAGATTTCAGAAGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015718
NOX3 MISSION shRNA shRNA Plasmid DNA
NADPH oxidase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015718.2-316s21c1
Sequence:CCAGTGTCAGTCGAAACCTTATTTCCTCGAGGAAATAAGGTTTCGACTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015718.2-1511s21c1
Sequence:CCGGCACTTTCTGAGTTATCATATACTCGAGTATATGATAACTCAGAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015718.2-1594s21c1
Sequence:CCGGTGACGTGATTACAGGCTTAAACTCGAGTTTAAGCCTGTAATCACGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-584s1c1
Sequence:CCGGCCCACAAACACAACCACTGAACTCGAGTTCAGTGGTTGTGTTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-458s1c1
Sequence:CCGGGCGCATTTCTTCAACCTGGAACTCGAGTTCCAGGTTGAAGAAATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-138s1c1
Sequence:CCGGCCACCATATTAGTACTCTCATCTCGAGATGAGAGTACTAATATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-1636s1c1
Sequence:CCGGGCCCAACTGGAACAATGAGTTCTCGAGAACTCATTGTTCCAGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-1346s1c1
Sequence:CCGGGCTGCTCTTCTGAAATCTATACTCGAGTATAGATTTCAGAAGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015718
NOX3 MISSION shRNA Lentiviral Transduction Particles
NADPH oxidase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015718.2-316s21c1
Sequence:CCAGTGTCAGTCGAAACCTTATTTCCTCGAGGAAATAAGGTTTCGACTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015718.2-1511s21c1
Sequence:CCGGCACTTTCTGAGTTATCATATACTCGAGTATATGATAACTCAGAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015718.2-1594s21c1
Sequence:CCGGTGACGTGATTACAGGCTTAAACTCGAGTTTAAGCCTGTAATCACGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-584s1c1
Sequence:CCGGCCCACAAACACAACCACTGAACTCGAGTTCAGTGGTTGTGTTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-458s1c1
Sequence:CCGGGCGCATTTCTTCAACCTGGAACTCGAGTTCCAGGTTGAAGAAATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-138s1c1
Sequence:CCGGCCACCATATTAGTACTCTCATCTCGAGATGAGAGTACTAATATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-1636s1c1
Sequence:CCGGGCCCAACTGGAACAATGAGTTCTCGAGAACTCATTGTTCCAGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015718.1-1346s1c1
Sequence:CCGGGCTGCTCTTCTGAAATCTATACTCGAGTATAGATTTCAGAAGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)