EMAIL THIS PAGE TO A FRIEND

NOXA1

NADPH oxidase activator 1

38 Gene Product Result for
Synonyms: NY-CO-31 SDCCAG31 p51NOX
UniProtKB ID: Q86UR1, O60533, Q29VU9, Q29VV0, Q2TAM1, Q8IUS3
Gene ID:
Human(10811) Summary: This gene encodes a protein which activates NADPH oxidases, enzymes which catalyze a reaction generating reactive oxygen species. The encoded protein contains four N-terminal tetratricopeptide domains and a C-terminal Src homology 3 domain. Interaction between the encoded protein and proteins in the oxidase regulatory complex occur via the tetratricopeptide domains. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(241275) NADPH oxidase activator 1
Rat(311793) NADPH oxidase activator 1
Zebrafish(556318) NADPH oxidase activator 1
domestic cat(101085327) NADPH oxidase activator 1
cow(523157) NADPH oxidase activator 1
dog(100125338) NADPH oxidase activator 1
chicken(417282) NADPH oxidase activator 1
sheep(101104479) NADPH oxidase activator 1
naked mole-rat(101706477) NADPH oxidase activator 1
domestic guinea pig(100713479) NADPH oxidase activator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041231 MISSION® esiRNA targeting human NOXA1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006647 Rosetta Predictions human pricing
NM_001100171 Rosetta Predictions rat pricing
NM_172204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132474 predicted 614 154.00
2 SASI_Hs01_00132475 predicted 638 154.00
3 SASI_Hs02_00342015 predicted 370 154.00
4 SASI_Hs01_00132476 predicted 509 154.00
5 SASI_Hs01_00132477 predicted 334 154.00
6 SASI_Hs01_00132478 predicted 707 154.00
7 SASI_Hs01_00132479 predicted 592 154.00
8 SASI_Hs01_00132481 predicted 817 154.00
9 SASI_Hs01_00132483 predicted 708 154.00
10 SASI_Hs02_00342016 predicted 397 154.00
11 SASI_Hs01_00132480 predicted 827 154.00
12 SASI_Hs01_00132482 predicted 1209 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209804 predicted 835 154.00
2 SASI_Rn02_00209805 predicted 839 154.00
3 SASI_Rn02_00209806 predicted 906 154.00
4 SASI_Rn02_00209807 predicted 926 154.00
5 SASI_Rn02_00209808 predicted 852 154.00
6 SASI_Rn02_00209809 predicted 936 154.00
7 SASI_Rn02_00209810 predicted 586 154.00
8 SASI_Rn02_00209811 predicted 852 154.00
9 SASI_Rn02_00209812 predicted 608 154.00
10 SASI_Rn02_00209813 predicted 690 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161072 predicted 1061 154.00
2 SASI_Mm01_00161073 predicted 287 154.00
3 SASI_Mm01_00161074 predicted 349 154.00
4 SASI_Mm01_00161076 predicted 332 154.00
5 SASI_Mm01_00161077 predicted 1124 154.00
6 SASI_Mm01_00161078 predicted 1332 154.00
7 SASI_Mm01_00161079 predicted 525 154.00
8 SASI_Mm01_00161080 predicted 633 154.00
9 SASI_Mm01_00161081 predicted 1172 154.00
10 SASI_Mm02_00343717 predicted 1377 154.00
11 SASI_Mm01_00161075 predicted 1407 154.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006647
NOXA1 MISSION shRNA Bacterial Glycerol Stock
NADPH oxidase activator 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-1186s1c1
Sequence:CCGGCTTGGGCAACTCAGTTACCTACTCGAGTAGGTAACTGAGTTGCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-825s1c1
Sequence:CCGGTGATGCCAGGTCCCTAATCATCTCGAGATGATTAGGGACCTGGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-327s1c1
Sequence:CCGGCGTGACCAAGGACACCTGCATCTCGAGATGCAGGTGTCCTTGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-496s1c1
Sequence:CCGGGCCTGGGAGGTGCTACACAATCTCGAGATTGTGTAGCACCTCCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-1417s1c1
Sequence:CCGGGTCCTGTGTGAAGAGCCCGATCTCGAGATCGGGCTCTTCACACAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006647.1-378s21c1
Sequence:CCGGCAACTTCCAGCTGGCAAGGTTCTCGAGAACCTTGCCAGCTGGAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006647.1-888s21c1
Sequence:CCGGAGAGACAGAGGTCGGTGCTGACTCGAGTCAGCACCGACCTCTGTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006647.1-712s21c1
Sequence:CCGGCACTTGGAGCCCGTGGATTTCCTCGAGGAAATCCACGGGCTCCAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006647
NOXA1 MISSION shRNA shRNA Plasmid DNA
NADPH oxidase activator 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-1186s1c1
Sequence:CCGGCTTGGGCAACTCAGTTACCTACTCGAGTAGGTAACTGAGTTGCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-825s1c1
Sequence:CCGGTGATGCCAGGTCCCTAATCATCTCGAGATGATTAGGGACCTGGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-327s1c1
Sequence:CCGGCGTGACCAAGGACACCTGCATCTCGAGATGCAGGTGTCCTTGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-496s1c1
Sequence:CCGGGCCTGGGAGGTGCTACACAATCTCGAGATTGTGTAGCACCTCCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-1417s1c1
Sequence:CCGGGTCCTGTGTGAAGAGCCCGATCTCGAGATCGGGCTCTTCACACAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006647.1-378s21c1
Sequence:CCGGCAACTTCCAGCTGGCAAGGTTCTCGAGAACCTTGCCAGCTGGAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006647.1-888s21c1
Sequence:CCGGAGAGACAGAGGTCGGTGCTGACTCGAGTCAGCACCGACCTCTGTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006647.1-712s21c1
Sequence:CCGGCACTTGGAGCCCGTGGATTTCCTCGAGGAAATCCACGGGCTCCAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006647
NOXA1 MISSION shRNA Lentiviral Transduction Particles
NADPH oxidase activator 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-1186s1c1
Sequence:CCGGCTTGGGCAACTCAGTTACCTACTCGAGTAGGTAACTGAGTTGCCCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000046079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-825s1c1
Sequence:CCGGTGATGCCAGGTCCCTAATCATCTCGAGATGATTAGGGACCTGGCATCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000046080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-327s1c1
Sequence:CCGGCGTGACCAAGGACACCTGCATCTCGAGATGCAGGTGTCCTTGGTCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000046081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-496s1c1
Sequence:CCGGGCCTGGGAGGTGCTACACAATCTCGAGATTGTGTAGCACCTCCCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000046082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006647.1-1417s1c1
Sequence:CCGGGTCCTGTGTGAAGAGCCCGATCTCGAGATCGGGCTCTTCACACAGGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006647.1-378s21c1
Sequence:CCGGCAACTTCCAGCTGGCAAGGTTCTCGAGAACCTTGCCAGCTGGAAGTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000431565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006647.1-888s21c1
Sequence:CCGGAGAGACAGAGGTCGGTGCTGACTCGAGTCAGCACCGACCTCTGTCTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000434155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006647.1-712s21c1
Sequence:CCGGCACTTGGAGCCCGTGGATTTCCTCGAGGAAATCCACGGGCTCCAAGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172204
NOXA1 MISSION shRNA Bacterial Glycerol Stock
NADPH oxidase activator 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-380s1c1
Sequence:CCGGGCTGGCTAGGATGTACTTTAACTCGAGTTAAAGTACATCCTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-962s1c1
Sequence:CCGGGCCATCCTCATCTACGTGTAACTCGAGTTACACGTAGATGAGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-1304s1c1
Sequence:CCGGGCAGAGTATATGGAGGAATGTCTCGAGACATTCCTCCATATACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-1377s1c1
Sequence:CCGGCCAGTCCTCTACCAAGTAGTACTCGAGTACTACTTGGTAGAGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-1016s1c1
Sequence:CCGGCCCTGGCCTATATGATAGTTTCTCGAGAAACTATCATATAGGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172204
NOXA1 MISSION shRNA shRNA Plasmid DNA
NADPH oxidase activator 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-380s1c1
Sequence:CCGGGCTGGCTAGGATGTACTTTAACTCGAGTTAAAGTACATCCTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-962s1c1
Sequence:CCGGGCCATCCTCATCTACGTGTAACTCGAGTTACACGTAGATGAGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-1304s1c1
Sequence:CCGGGCAGAGTATATGGAGGAATGTCTCGAGACATTCCTCCATATACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-1377s1c1
Sequence:CCGGCCAGTCCTCTACCAAGTAGTACTCGAGTACTACTTGGTAGAGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-1016s1c1
Sequence:CCGGCCCTGGCCTATATGATAGTTTCTCGAGAAACTATCATATAGGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172204
NOXA1 MISSION shRNA Lentiviral Transduction Particles
NADPH oxidase activator 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-380s1c1
Sequence:CCGGGCTGGCTAGGATGTACTTTAACTCGAGTTAAAGTACATCCTAGCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000076607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-962s1c1
Sequence:CCGGGCCATCCTCATCTACGTGTAACTCGAGTTACACGTAGATGAGGATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000076606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-1304s1c1
Sequence:CCGGGCAGAGTATATGGAGGAATGTCTCGAGACATTCCTCCATATACTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000076605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-1377s1c1
Sequence:CCGGCCAGTCCTCTACCAAGTAGTACTCGAGTACTACTTGGTAGAGGACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000076603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172204.2-1016s1c1
Sequence:CCGGCCCTGGCCTATATGATAGTTTCTCGAGAAACTATCATATAGGCCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???