EMAIL THIS PAGE TO A FRIEND

NOXO1

NADPH oxidase organizer 1

75 Gene Product Result for
Synonyms: P41NOX P41NOXA P41NOXB P41NOXC SH3PXD5 SNX28
UniProtKB ID: Q8NFA2, Q86YM1, Q8NFA3, Q96B73
Gene ID:
Human(124056) Summary: This gene encodes an NADPH oxidase (NOX) organizer, which positively regulates NOX1 and NOX3. The protein contains a PX domain and two SH3 domains. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Mouse(71893) NADPH oxidase organizer 1
Rat(302976) NADPH oxidase organizer 1
domestic guinea pig(100731784) NADPH oxidase organizer 1
naked mole-rat(101722685) NADPH oxidase organizer 1
sheep(101112873) NADPH oxidase organizer 1
chicken(416546) NADPH oxidase organizer 1
dog(490063) NADPH oxidase organizer 1
domestic cat(101083992) NADPH oxidase organizer 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152701 MISSION® esiRNA esiRNA human NOXO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144603 Rosetta Predictions human pricing
NM_172167 Rosetta Predictions human pricing
NM_172168 Rosetta Predictions human pricing
NM_001106986 Rosetta Predictions rat pricing
NM_027988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232507 predicted 1025
2 SASI_Hs01_00232509 predicted 868
3 SASI_Hs01_00232510 predicted 1023
4 SASI_Hs01_00232511 predicted 1049
5 SASI_Hs01_00232512 predicted 965
6 SASI_Hs01_00232513 predicted 1054
7 SASI_Hs01_00232514 predicted 1077
8 SASI_Hs02_00364405 predicted 707
9 SASI_Hs01_00232516 predicted 1131
10 SASI_Hs02_00364406 predicted 984
11 SASI_Hs01_00232508 predicted 871
12 SASI_Hs01_00232515 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105587 predicted 771
2 SASI_Hs01_00105589 predicted 618
3 SASI_Hs01_00105590 predicted 765
4 SASI_Hs01_00105591 predicted 794
5 SASI_Hs01_00105592 predicted 718
6 SASI_Hs01_00105593 predicted 802
7 SASI_Hs01_00105594 predicted 816
8 SASI_Hs02_00367866 predicted 450
9 SASI_Hs01_00105596 predicted 875
10 SASI_Hs02_00367867 predicted 730
11 SASI_Hs01_00105588 predicted 615
12 SASI_Hs01_00105595 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120392 predicted 790
2 SASI_Hs01_00120394 predicted 634
3 SASI_Hs01_00120395 predicted 784
4 SASI_Hs01_00120396 predicted 810
5 SASI_Hs01_00120397 predicted 724
6 SASI_Hs01_00120398 predicted 817
7 SASI_Hs01_00120399 predicted 831
8 SASI_Hs02_00367868 predicted 465
9 SASI_Hs01_00120401 predicted 886
10 SASI_Hs02_00367869 predicted 746
11 SASI_Hs01_00120393 predicted 628
12 SASI_Hs01_00120400 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224356 predicted 902
2 SASI_Rn02_00224357 predicted 693
3 SASI_Rn02_00224358 predicted 787
4 SASI_Rn02_00224359 predicted 1292
5 SASI_Rn02_00224360 predicted 1165
6 SASI_Rn02_00224361 predicted 1181
7 SASI_Rn02_00224362 predicted 731
8 SASI_Rn02_00224363 predicted 567
9 SASI_Rn02_00224364 predicted 786
10 SASI_Rn02_00224365 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333049 predicted 340
2 SASI_Mm01_00082393 predicted 418
3 SASI_Mm01_00082394 predicted 517
4 SASI_Mm02_00333050 predicted 698
5 SASI_Mm01_00082400 predicted 334
6 SASI_Mm02_00333051 predicted 770
7 SASI_Mm02_00333052 predicted 314
8 SASI_Mm02_00333053 predicted 447
9 SASI_Mm02_00333054 predicted 557
10 SASI_Mm02_00333055 predicted 397
11 SASI_Mm01_00082391 predicted 1197
12 SASI_Mm01_00082392 predicted 318
13 SASI_Mm01_00082395 predicted 841
14 SASI_Mm01_00082396 predicted 202
15 SASI_Mm01_00082397 predicted 291
16 SASI_Mm01_00082398 predicted 1040
17 SASI_Mm01_00082399 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144603
NOXO1 MISSION shRNA Bacterial Glycerol Stock
NADPH oxidase organizer 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144603.2-543s21c1
Sequence:CCGGGAAACCTATTCTCGGAGGCTGCTCGAGCAGCCTCCGAGAATAGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144603.2-373s21c1
Sequence:CCGGTGCGCAGGAGTTGGGACGAATCTCGAGATTCGTCCCAACTCCTGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144603.2-320s21c1
Sequence:CCGGGCTCCAAACGTTTGCCTTCTCCTCGAGGAGAAGGCAAACGTTTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-307s1c1
Sequence:CCGGTGCAGATCAAGAGGCTCCAAACTCGAGTTTGGAGCCTCTTGATCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-473s1c1
Sequence:CCGGGCTTCTCGATGCACCACTGTTCTCGAGAACAGTGGTGCATCGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-1034s1c1
Sequence:CCGGGCGCGTGTTGGAAACGTCAGACTCGAGTCTGACGTTTCCAACACGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-462s1c1
Sequence:CCGGGTTCTCCCAAAGCTTCTCGATCTCGAGATCGAGAAGCTTTGGGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144603
NOXO1 MISSION shRNA shRNA Plasmid DNA
NADPH oxidase organizer 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144603.2-543s21c1
Sequence:CCGGGAAACCTATTCTCGGAGGCTGCTCGAGCAGCCTCCGAGAATAGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144603.2-373s21c1
Sequence:CCGGTGCGCAGGAGTTGGGACGAATCTCGAGATTCGTCCCAACTCCTGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144603.2-320s21c1
Sequence:CCGGGCTCCAAACGTTTGCCTTCTCCTCGAGGAGAAGGCAAACGTTTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-307s1c1
Sequence:CCGGTGCAGATCAAGAGGCTCCAAACTCGAGTTTGGAGCCTCTTGATCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-473s1c1
Sequence:CCGGGCTTCTCGATGCACCACTGTTCTCGAGAACAGTGGTGCATCGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-1034s1c1
Sequence:CCGGGCGCGTGTTGGAAACGTCAGACTCGAGTCTGACGTTTCCAACACGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-462s1c1
Sequence:CCGGGTTCTCCCAAAGCTTCTCGATCTCGAGATCGAGAAGCTTTGGGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144603
NOXO1 MISSION shRNA Lentiviral Transduction Particles
NADPH oxidase organizer 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144603.2-543s21c1
Sequence:CCGGGAAACCTATTCTCGGAGGCTGCTCGAGCAGCCTCCGAGAATAGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144603.2-373s21c1
Sequence:CCGGTGCGCAGGAGTTGGGACGAATCTCGAGATTCGTCCCAACTCCTGCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144603.2-320s21c1
Sequence:CCGGGCTCCAAACGTTTGCCTTCTCCTCGAGGAGAAGGCAAACGTTTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-307s1c1
Sequence:CCGGTGCAGATCAAGAGGCTCCAAACTCGAGTTTGGAGCCTCTTGATCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-473s1c1
Sequence:CCGGGCTTCTCGATGCACCACTGTTCTCGAGAACAGTGGTGCATCGAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-1034s1c1
Sequence:CCGGGCGCGTGTTGGAAACGTCAGACTCGAGTCTGACGTTTCCAACACGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144603.2-462s1c1
Sequence:CCGGGTTCTCCCAAAGCTTCTCGATCTCGAGATCGAGAAGCTTTGGGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027988
NOXO1 MISSION shRNA Bacterial Glycerol Stock
NADPH oxidase organizer 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027988.1-1418s1c2
Sequence:CCGGGCAGAGAGGTTGTACTGTCAACTCGAGTTGACAGTACAACCTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027988.3-732s21c1
Sequence:CCGGCAGTCGCTCTGATGAGCTATCCTCGAGGATAGCTCATCAGAGCGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027988.3-534s21c1
Sequence:CCGGCCACACCAAGGCTCAAGAAATCTCGAGATTTCTTGAGCCTTGGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027988.3-33s21c1
Sequence:CCGGTGCTGTAGCCTTGGTGCAAATCTCGAGATTTGCACCAAGGCTACAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-299s1c2
Sequence:CCGGCGGAGATCTGAACAAGTTCTTCTCGAGAAGAACTTGTTCAGATCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-455s1c1
Sequence:CCGGCACGGCTTCTTTGTACCCAAACTCGAGTTTGGGTACAAAGAAGCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-665s1c1
Sequence:CCGGCTGGACATATTACTACGACATCTCGAGATGTCGTAGTAATATGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-454s1c1
Sequence:CCGGTCACGGCTTCTTTGTACCCAACTCGAGTTGGGTACAAAGAAGCCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027988
NOXO1 MISSION shRNA shRNA Plasmid DNA
NADPH oxidase organizer 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027988.1-1418s1c2
Sequence:CCGGGCAGAGAGGTTGTACTGTCAACTCGAGTTGACAGTACAACCTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027988.3-732s21c1
Sequence:CCGGCAGTCGCTCTGATGAGCTATCCTCGAGGATAGCTCATCAGAGCGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027988.3-534s21c1
Sequence:CCGGCCACACCAAGGCTCAAGAAATCTCGAGATTTCTTGAGCCTTGGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027988.3-33s21c1
Sequence:CCGGTGCTGTAGCCTTGGTGCAAATCTCGAGATTTGCACCAAGGCTACAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-299s1c2
Sequence:CCGGCGGAGATCTGAACAAGTTCTTCTCGAGAAGAACTTGTTCAGATCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-455s1c1
Sequence:CCGGCACGGCTTCTTTGTACCCAAACTCGAGTTTGGGTACAAAGAAGCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-665s1c1
Sequence:CCGGCTGGACATATTACTACGACATCTCGAGATGTCGTAGTAATATGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-454s1c1
Sequence:CCGGTCACGGCTTCTTTGTACCCAACTCGAGTTGGGTACAAAGAAGCCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027988
NOXO1 MISSION shRNA Lentiviral Transduction Particles
NADPH oxidase organizer 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027988.1-1418s1c2
Sequence:CCGGGCAGAGAGGTTGTACTGTCAACTCGAGTTGACAGTACAACCTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027988.3-732s21c1
Sequence:CCGGCAGTCGCTCTGATGAGCTATCCTCGAGGATAGCTCATCAGAGCGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027988.3-534s21c1
Sequence:CCGGCCACACCAAGGCTCAAGAAATCTCGAGATTTCTTGAGCCTTGGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027988.3-33s21c1
Sequence:CCGGTGCTGTAGCCTTGGTGCAAATCTCGAGATTTGCACCAAGGCTACAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-299s1c2
Sequence:CCGGCGGAGATCTGAACAAGTTCTTCTCGAGAAGAACTTGTTCAGATCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-455s1c1
Sequence:CCGGCACGGCTTCTTTGTACCCAAACTCGAGTTTGGGTACAAAGAAGCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-665s1c1
Sequence:CCGGCTGGACATATTACTACGACATCTCGAGATGTCGTAGTAATATGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027988.1-454s1c1
Sequence:CCGGTCACGGCTTCTTTGTACCCAACTCGAGTTGGGTACAAAGAAGCCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)