EMAIL THIS PAGE TO A FRIEND

NOXRED1

NADP-dependent oxidoreductase domain containing 1

71 Gene Product Result for
Synonyms: C14orf148
UniProtKB ID: Q6NXP6, B3KQ47, O95435
Gene ID:
Mouse(71275) NADP+ dependent oxidoreductase domain containing 1
Rat(681924) NADP-dependent oxidoreductase domain containing 1
chicken(772029) NADP-dependent oxidoreductase domain containing 1
domestic cat(101080545) NADP-dependent oxidoreductase domain containing 1
cow(515802) NADP-dependent oxidoreductase domain containing 1
dog(612032) NADP-dependent oxidoreductase domain containing 1
sheep(101110849) NADP-dependent oxidoreductase domain containing 1
naked mole-rat(101720351) NADP-dependent oxidoreductase domain containing 1
domestic guinea pig(100727964) NADP-dependent oxidoreductase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138791 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU177961 MISSION® esiRNA esiRNA targeting mouse 4933437F05Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113475 Rosetta Predictions human pricing
NM_138791 Rosetta Predictions human pricing
XM_001058984 Rosetta Predictions rat pricing
NM_027744 Rosetta Predictions mouse pricing
XM_127023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325861 predicted 576
2 SASI_Hs02_00325862 predicted 481
3 SASI_Hs02_00325863 predicted 539
4 SASI_Hs02_00325864 predicted 537
5 SASI_Hs02_00325865 predicted 585
6 SASI_Hs02_00325866 predicted 551
7 SASI_Hs02_00325867 predicted 450
8 SASI_Hs02_00325868 predicted 553
9 SASI_Hs02_00325869 predicted 459
10 SASI_Hs02_00325870 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013594 predicted 435
2 SASI_Hs02_00363934 predicted 331
3 SASI_Hs01_00013596 predicted 387
4 SASI_Hs01_00013597 predicted 393
5 SASI_Hs01_00013599 predicted 442
6 SASI_Hs02_00363935 predicted 400
7 SASI_Hs01_00013600 predicted 298
8 SASI_Hs01_00013601 predicted 404
9 SASI_Hs02_00363936 predicted 314
10 SASI_Hs02_00363937 predicted 326
11 SASI_Hs01_00013595 predicted 475
12 SASI_Hs01_00013598 predicted 224
13 SASI_Hs01_00013602 predicted 488
14 SASI_Hs01_00013603 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291516 predicted 974
2 SASI_Rn02_00291517 predicted 935
3 SASI_Rn02_00291518 predicted 500
4 SASI_Rn02_00291519 predicted 385
5 SASI_Rn02_00291520 predicted 302
6 SASI_Rn02_00291521 predicted 1157
7 SASI_Rn02_00291522 predicted 276
8 SASI_Rn02_00291523 predicted 299
9 SASI_Rn02_00291524 predicted 1095
10 SASI_Rn02_00291525 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332690 predicted 1029
2 SASI_Mm02_00332691 predicted 905
3 SASI_Mm02_00332692 predicted 862
4 SASI_Mm02_00332693 predicted 901
5 SASI_Mm02_00332694 predicted 420
6 SASI_Mm02_00332695 predicted 236
7 SASI_Mm02_00332696 predicted 987
8 SASI_Mm02_00332697 predicted 445
9 SASI_Mm02_00332698 predicted 626
10 SASI_Mm02_00332699 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253467 predicted 537
2 SASI_Mm01_00253468 predicted 607
3 SASI_Mm01_00253469 predicted 332
4 SASI_Mm01_00253470 predicted 506
5 SASI_Mm01_00253471 predicted 556
6 SASI_Mm01_00253472 predicted 370
7 SASI_Mm01_00253473 predicted 365
8 SASI_Mm01_00253474 predicted 475
9 SASI_Mm01_00253475 predicted 452
10 SASI_Mm01_00253476 predicted 589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138791
NOXRED1 MISSION shRNA Bacterial Glycerol Stock
NADP-dependent oxidoreductase domain containing 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138791.1-355s1c1
Sequence:CCGGCTCCAGAAGCTGGGAATCAAACTCGAGTTTGATTCCCAGCTTCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-121s1c1
Sequence:CCGGGCAACCTTCTTCTGCAAACTACTCGAGTAGTTTGCAGAAGAAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138791.1-122s1c1
Sequence:CCGGCAACCTTCTTCTGCAAACTATCTCGAGATAGTTTGCAGAAGAAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138791.1-543s1c1
Sequence:CCGGGTTGAACCACACCAATATCTTCTCGAGAAGATATTGGTGTGGTTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-459s1c1
Sequence:CCGGCGTAGAAATTTACACCAGCCTCTCGAGAGGCTGGTGTAAATTTCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-410s1c1
Sequence:CCGGCCGATGTGATATTCCTCTGCTCTCGAGAGCAGAGGAATATCACATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-565s1c1
Sequence:CCGGCGGCCTCAGTATCAGTATGATCTCGAGATCATACTGATACTGAGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-487s1c1
Sequence:CCGGGCCAGCATTGTGTACAGCTTTCTCGAGAAAGCTGTACACAATGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-227s21c1
Sequence:CCGGAGTTTAAGGTGGGCATCATTGCTCGAGCAATGATGCCCACCTTAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-356s21c1
Sequence:CCGGTCCAGAAGCTGGGAATCAAATCTCGAGATTTGATTCCCAGCTTCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-539s21c1
Sequence:CCGGTACTGTTGAACCACACCAATACTCGAGTATTGGTGTGGTTCAACAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-58s21c1
Sequence:CCGGGATCGTATCTGGCTGTATTTGCTCGAGCAAATACAGCCAGATACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138791
NOXRED1 MISSION shRNA shRNA Plasmid DNA
NADP-dependent oxidoreductase domain containing 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138791.1-355s1c1
Sequence:CCGGCTCCAGAAGCTGGGAATCAAACTCGAGTTTGATTCCCAGCTTCTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-121s1c1
Sequence:CCGGGCAACCTTCTTCTGCAAACTACTCGAGTAGTTTGCAGAAGAAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138791.1-122s1c1
Sequence:CCGGCAACCTTCTTCTGCAAACTATCTCGAGATAGTTTGCAGAAGAAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138791.1-543s1c1
Sequence:CCGGGTTGAACCACACCAATATCTTCTCGAGAAGATATTGGTGTGGTTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-459s1c1
Sequence:CCGGCGTAGAAATTTACACCAGCCTCTCGAGAGGCTGGTGTAAATTTCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-410s1c1
Sequence:CCGGCCGATGTGATATTCCTCTGCTCTCGAGAGCAGAGGAATATCACATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-565s1c1
Sequence:CCGGCGGCCTCAGTATCAGTATGATCTCGAGATCATACTGATACTGAGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-487s1c1
Sequence:CCGGGCCAGCATTGTGTACAGCTTTCTCGAGAAAGCTGTACACAATGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-227s21c1
Sequence:CCGGAGTTTAAGGTGGGCATCATTGCTCGAGCAATGATGCCCACCTTAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-356s21c1
Sequence:CCGGTCCAGAAGCTGGGAATCAAATCTCGAGATTTGATTCCCAGCTTCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-539s21c1
Sequence:CCGGTACTGTTGAACCACACCAATACTCGAGTATTGGTGTGGTTCAACAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-58s21c1
Sequence:CCGGGATCGTATCTGGCTGTATTTGCTCGAGCAAATACAGCCAGATACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138791
NOXRED1 MISSION shRNA Lentiviral Transduction Particles
NADP-dependent oxidoreductase domain containing 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138791.1-355s1c1
Sequence:CCGGCTCCAGAAGCTGGGAATCAAACTCGAGTTTGATTCCCAGCTTCTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-121s1c1
Sequence:CCGGGCAACCTTCTTCTGCAAACTACTCGAGTAGTTTGCAGAAGAAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138791.1-122s1c1
Sequence:CCGGCAACCTTCTTCTGCAAACTATCTCGAGATAGTTTGCAGAAGAAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138791.1-543s1c1
Sequence:CCGGGTTGAACCACACCAATATCTTCTCGAGAAGATATTGGTGTGGTTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-459s1c1
Sequence:CCGGCGTAGAAATTTACACCAGCCTCTCGAGAGGCTGGTGTAAATTTCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-410s1c1
Sequence:CCGGCCGATGTGATATTCCTCTGCTCTCGAGAGCAGAGGAATATCACATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-565s1c1
Sequence:CCGGCGGCCTCAGTATCAGTATGATCTCGAGATCATACTGATACTGAGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138791.1-487s1c1
Sequence:CCGGGCCAGCATTGTGTACAGCTTTCTCGAGAAAGCTGTACACAATGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-227s21c1
Sequence:CCGGAGTTTAAGGTGGGCATCATTGCTCGAGCAATGATGCCCACCTTAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-356s21c1
Sequence:CCGGTCCAGAAGCTGGGAATCAAATCTCGAGATTTGATTCCCAGCTTCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-539s21c1
Sequence:CCGGTACTGTTGAACCACACCAATACTCGAGTATTGGTGTGGTTCAACAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138791.1-58s21c1
Sequence:CCGGGATCGTATCTGGCTGTATTTGCTCGAGCAAATACAGCCAGATACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027744
NOXRED1 MISSION shRNA Bacterial Glycerol Stock
NADP-dependent oxidoreductase domain containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-249s21c1
Sequence:CCGGCTGTACTTACAGGGCCGTTATCTCGAGATAACGGCCCTGTAAGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-760s21c1
Sequence:CCGGACCAATTTGCTGAGGATTATGCTCGAGCATAATCCTCAGCAAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-818s21c1
Sequence:CCGGTCTCCAAGATACAACGATTATCTCGAGATAATCGTTGTATCTTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-322s21c1
Sequence:CCGGTCTCTACTTTGAGCAACTTATCTCGAGATAAGTTGCTCAAAGTAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-412s21c1
Sequence:CCGGTGCTAACCGTGGGCATCATTGCTCGAGCAATGATGCCCACGGTTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-1224s21c1
Sequence:CCGGGAAGAAGAATTGCCTTATATTCTCGAGAATATAAGGCAATTCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027744
NOXRED1 MISSION shRNA shRNA Plasmid DNA
NADP-dependent oxidoreductase domain containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-249s21c1
Sequence:CCGGCTGTACTTACAGGGCCGTTATCTCGAGATAACGGCCCTGTAAGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-760s21c1
Sequence:CCGGACCAATTTGCTGAGGATTATGCTCGAGCATAATCCTCAGCAAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-818s21c1
Sequence:CCGGTCTCCAAGATACAACGATTATCTCGAGATAATCGTTGTATCTTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-322s21c1
Sequence:CCGGTCTCTACTTTGAGCAACTTATCTCGAGATAAGTTGCTCAAAGTAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-412s21c1
Sequence:CCGGTGCTAACCGTGGGCATCATTGCTCGAGCAATGATGCCCACGGTTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-1224s21c1
Sequence:CCGGGAAGAAGAATTGCCTTATATTCTCGAGAATATAAGGCAATTCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027744
NOXRED1 MISSION shRNA Lentiviral Transduction Particles
NADP-dependent oxidoreductase domain containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-249s21c1
Sequence:CCGGCTGTACTTACAGGGCCGTTATCTCGAGATAACGGCCCTGTAAGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-760s21c1
Sequence:CCGGACCAATTTGCTGAGGATTATGCTCGAGCATAATCCTCAGCAAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-818s21c1
Sequence:CCGGTCTCCAAGATACAACGATTATCTCGAGATAATCGTTGTATCTTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-322s21c1
Sequence:CCGGTCTCTACTTTGAGCAACTTATCTCGAGATAAGTTGCTCAAAGTAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-412s21c1
Sequence:CCGGTGCTAACCGTGGGCATCATTGCTCGAGCAATGATGCCCACGGTTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027744.1-1224s21c1
Sequence:CCGGGAAGAAGAATTGCCTTATATTCTCGAGAATATAAGGCAATTCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)