EMAIL THIS PAGE TO A FRIEND

NPAP1

nuclear pore associated protein 1

182 Gene Product Result for
Synonyms: C15orf2
Species: Human NPAP1(23742)
UniProtKB ID: Q9NZP6
Gene ID:
Human(23742) Summary: This gene is located in the Prader-Willi syndrome region on chromosome 15. This gene is biallelically expressed in adult testis and brain but is paternally imprinted in fetal brain. Defects in this gene may be associated with Prader-Willi syndrome. [provided by RefSeq, Aug 2012]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018958 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150641 MISSION® esiRNA esiRNA human C15orf2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018958 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076409 predicted 2534
2 SASI_Hs01_00076411 predicted 2614
3 SASI_Hs01_00076412 predicted 2547
4 SASI_Hs02_00352431 predicted 469
5 SASI_Hs01_00076413 predicted 3280
6 SASI_Hs01_00076414 predicted 2925
7 SASI_Hs01_00076416 predicted 3102
8 SASI_Hs01_00076417 predicted 1368
9 SASI_Hs02_00352432 predicted 3907
10 SASI_Hs02_00352433 predicted 2478
11 SASI_Hs01_00076410 predicted 2895
12 SASI_Hs01_00076415 predicted 2859
13 SASI_Hs01_00076418 predicted 2446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018958
NPAP1 MISSION shRNA Bacterial Glycerol Stock
nuclear pore associated protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018958.2-3728s21c1
Sequence:CCGGCCGCCTACATTCCTGGTTTAGCTCGAGCTAAACCAGGAATGTAGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1844s1c1
Sequence:CCGGGAAAGACATCAGTCTACACATCTCGAGATGTGTAGACTGATGTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1546s1c1
Sequence:CCGGCCAATATCTATGTGTGTGGATCTCGAGATCCACACACATAGATATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-2813s1c1
Sequence:CCGGGCAGCATAATTCCACCAGGTTCTCGAGAACCTGGTGGAATTATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018958.2-2900s21c1
Sequence:CCGGGTGCCTCTGCAGCATCGTTATCTCGAGATAACGATGCTGCAGAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1664s1c1
Sequence:CCGGCCACTGTCACAACAAACGCATCTCGAGATGCGTTTGTTGTGACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-2836s1c1
Sequence:CCGGGCAGAGTTAACATCACCATATCTCGAGATATGGTGATGTTAACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-2663s1c1
Sequence:CCGGGCCATCCTTTAAATACAGGATCTCGAGATCCTGTATTTAAAGGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1430s1c1
Sequence:CCGGCTAATGAGAAAGGAGGCTCTTCTCGAGAAGAGCCTCCTTTCTCATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018958
NPAP1 MISSION shRNA shRNA Plasmid DNA
nuclear pore associated protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018958.2-3728s21c1
Sequence:CCGGCCGCCTACATTCCTGGTTTAGCTCGAGCTAAACCAGGAATGTAGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1844s1c1
Sequence:CCGGGAAAGACATCAGTCTACACATCTCGAGATGTGTAGACTGATGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1546s1c1
Sequence:CCGGCCAATATCTATGTGTGTGGATCTCGAGATCCACACACATAGATATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-2813s1c1
Sequence:CCGGGCAGCATAATTCCACCAGGTTCTCGAGAACCTGGTGGAATTATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018958.2-2900s21c1
Sequence:CCGGGTGCCTCTGCAGCATCGTTATCTCGAGATAACGATGCTGCAGAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1664s1c1
Sequence:CCGGCCACTGTCACAACAAACGCATCTCGAGATGCGTTTGTTGTGACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-2836s1c1
Sequence:CCGGGCAGAGTTAACATCACCATATCTCGAGATATGGTGATGTTAACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-2663s1c1
Sequence:CCGGGCCATCCTTTAAATACAGGATCTCGAGATCCTGTATTTAAAGGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1430s1c1
Sequence:CCGGCTAATGAGAAAGGAGGCTCTTCTCGAGAAGAGCCTCCTTTCTCATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018958
NPAP1 MISSION shRNA Lentiviral Transduction Particles
nuclear pore associated protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018958.2-3728s21c1
Sequence:CCGGCCGCCTACATTCCTGGTTTAGCTCGAGCTAAACCAGGAATGTAGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1844s1c1
Sequence:CCGGGAAAGACATCAGTCTACACATCTCGAGATGTGTAGACTGATGTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1546s1c1
Sequence:CCGGCCAATATCTATGTGTGTGGATCTCGAGATCCACACACATAGATATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-2813s1c1
Sequence:CCGGGCAGCATAATTCCACCAGGTTCTCGAGAACCTGGTGGAATTATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018958.2-2900s21c1
Sequence:CCGGGTGCCTCTGCAGCATCGTTATCTCGAGATAACGATGCTGCAGAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1664s1c1
Sequence:CCGGCCACTGTCACAACAAACGCATCTCGAGATGCGTTTGTTGTGACAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-2836s1c1
Sequence:CCGGGCAGAGTTAACATCACCATATCTCGAGATATGGTGATGTTAACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-2663s1c1
Sequence:CCGGGCCATCCTTTAAATACAGGATCTCGAGATCCTGTATTTAAAGGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018958.1-1430s1c1
Sequence:CCGGCTAATGAGAAAGGAGGCTCTTCTCGAGAAGAGCCTCCTTTCTCATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)