EMAIL THIS PAGE TO A FRIEND

NPAS2

neuronal PAS domain protein 2

166 Gene Product Result for
Synonyms: MOP4 PASD4 bHLHe9
UniProtKB ID: Q99743, Q4ZFV9, Q53SQ3, Q86V96, Q99629
Gene ID:
Human(4862) Summary: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. A similar mouse protein may play a regulatory role in the acquisition of specific types of memory. It also may function as a part of a molecular clock operative in the mammalian forebrain. [provided by RefSeq, Jul 2008]
Mouse(18143) neuronal PAS domain protein 2
Rat(316351) neuronal PAS domain protein 2
Zebrafish(352934) neuronal PAS domain protein 2
chicken(395433) neuronal PAS domain protein 2
cow(614049) neuronal PAS domain protein 2
domestic cat(101082484) neuronal PAS domain protein 2
dog(474552) neuronal PAS domain protein 2
sheep(101104647) neuronal PAS domain protein 2
naked mole-rat(101703217) neuronal PAS domain protein 2
domestic guinea pig(100721253) neuronal PAS domain protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002518 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002518 Rosetta Predictions human pricing
NM_001108214 Rosetta Predictions rat pricing
XM_244089 Rosetta Predictions rat pricing
NM_008719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085053 predicted 1025
2 SASI_Hs01_00085054 predicted 2076
3 SASI_Hs01_00085055 predicted 1264
4 SASI_Hs01_00085056 predicted 1033
5 SASI_Hs01_00085057 predicted 720
6 SASI_Hs02_00333982 predicted 1047
7 SASI_Hs01_00085058 predicted 1005
8 SASI_Hs02_00333983 predicted 599
9 SASI_Hs01_00085059 predicted 1017
10 SASI_Hs01_00085060 predicted 508
11 SASI_Hs01_00085061 predicted 1780
12 SASI_Hs01_00085062 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236444 predicted 1402
2 SASI_Rn02_00236445 predicted 1841
3 SASI_Rn02_00236446 predicted 1316
4 SASI_Rn02_00236447 predicted 2064
5 SASI_Rn02_00236448 predicted 2416
6 SASI_Rn02_00236449 predicted 1300
7 SASI_Rn02_00236450 predicted 1521
8 SASI_Rn02_00236451 predicted 1369
9 SASI_Rn02_00236452 predicted 1726
10 SASI_Rn02_00236453 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_244089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126226 predicted 1094
2 SASI_Rn01_00126227 predicted 955
3 SASI_Rn01_00126228 predicted 1838
4 SASI_Rn01_00126229 predicted 2060
5 SASI_Rn01_00126230 predicted 572
6 SASI_Rn01_00126231 predicted 2606
7 SASI_Rn01_00126232 predicted 724
8 SASI_Rn01_00126233 predicted 1299
9 SASI_Rn01_00126234 predicted 1371
10 SASI_Rn01_00126235 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201377 predicted 898
2 SASI_Mm01_00201378 predicted 1102
3 SASI_Mm01_00201379 predicted 512
4 SASI_Mm01_00201380 predicted 1784
5 SASI_Mm01_00201381 predicted 1237
6 SASI_Mm01_00201382 predicted 930
7 SASI_Mm01_00201383 predicted 1395
8 SASI_Mm02_00314557 predicted 665
9 SASI_Mm01_00201385 predicted 1305
10 SASI_Mm01_00201386 predicted 870
11 SASI_Mm01_00201384 predicted 1418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002518
VALIDATED
NPAS2 MISSION shRNA Bacterial Glycerol Stock
neuronal PAS domain protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002518.2-1518s1c1
Sequence:CCGGCCTCAAGAAGTTCCCACAAATCTCGAGATTTGTGGGAACTTCTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002518.2-478s1c1
Sequence:CCGGGCAAACGGAAATCTGTGACATCTCGAGATGTCACAGATTTCCGTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002518.2-570s1c1
Sequence:CCGGGCTTCATTATCGCAGTGACAACTCGAGTTGTCACTGCGATAATGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002518.2-820s1c1
Sequence:CCGGCCCAAAGGAATTTCCAACTTACTCGAGTAAGTTGGAAATTCCTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002518.2-2123s1c1
Sequence:CCGGCCAATGAGAAGCTCACAGCTACTCGAGTAGCTGTGAGCTTCTCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-469s21c1
Sequence:CCGGAGTCTCAGCGCAAACGGAAATCTCGAGATTTCCGTTTGCGCTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-1137s21c1
Sequence:CCGGGCTATGACTACTACCACATTGCTCGAGCAATGTGGTAGTAGTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-3137s21c1
Sequence:CCGGTCACGCTCTTGATCGTCTTTCCTCGAGGAAAGACGATCAAGAGCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002518.3-976s21c1
Sequence:CCGGTCGTCTGGCAACACCACAATTCTCGAGAATTGTGGTGTTGCCAGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-1083s21c1
Sequence:CCGGACAGAGCACCTCCAATCATAGCTCGAGCTATGATTGGAGGTGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002518
VALIDATED
NPAS2 MISSION shRNA shRNA Plasmid DNA
neuronal PAS domain protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002518.2-1518s1c1
Sequence:CCGGCCTCAAGAAGTTCCCACAAATCTCGAGATTTGTGGGAACTTCTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002518.2-478s1c1
Sequence:CCGGGCAAACGGAAATCTGTGACATCTCGAGATGTCACAGATTTCCGTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002518.2-570s1c1
Sequence:CCGGGCTTCATTATCGCAGTGACAACTCGAGTTGTCACTGCGATAATGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002518.2-820s1c1
Sequence:CCGGCCCAAAGGAATTTCCAACTTACTCGAGTAAGTTGGAAATTCCTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002518.2-2123s1c1
Sequence:CCGGCCAATGAGAAGCTCACAGCTACTCGAGTAGCTGTGAGCTTCTCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-469s21c1
Sequence:CCGGAGTCTCAGCGCAAACGGAAATCTCGAGATTTCCGTTTGCGCTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-1137s21c1
Sequence:CCGGGCTATGACTACTACCACATTGCTCGAGCAATGTGGTAGTAGTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-3137s21c1
Sequence:CCGGTCACGCTCTTGATCGTCTTTCCTCGAGGAAAGACGATCAAGAGCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002518.3-976s21c1
Sequence:CCGGTCGTCTGGCAACACCACAATTCTCGAGAATTGTGGTGTTGCCAGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-1083s21c1
Sequence:CCGGACAGAGCACCTCCAATCATAGCTCGAGCTATGATTGGAGGTGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002518
VALIDATED
NPAS2 MISSION shRNA Lentiviral Transduction Particles
neuronal PAS domain protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002518.2-1518s1c1
Sequence:CCGGCCTCAAGAAGTTCCCACAAATCTCGAGATTTGTGGGAACTTCTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002518.2-478s1c1
Sequence:CCGGGCAAACGGAAATCTGTGACATCTCGAGATGTCACAGATTTCCGTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002518.2-570s1c1
Sequence:CCGGGCTTCATTATCGCAGTGACAACTCGAGTTGTCACTGCGATAATGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002518.2-820s1c1
Sequence:CCGGCCCAAAGGAATTTCCAACTTACTCGAGTAAGTTGGAAATTCCTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002518.2-2123s1c1
Sequence:CCGGCCAATGAGAAGCTCACAGCTACTCGAGTAGCTGTGAGCTTCTCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-469s21c1
Sequence:CCGGAGTCTCAGCGCAAACGGAAATCTCGAGATTTCCGTTTGCGCTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-1137s21c1
Sequence:CCGGGCTATGACTACTACCACATTGCTCGAGCAATGTGGTAGTAGTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-3137s21c1
Sequence:CCGGTCACGCTCTTGATCGTCTTTCCTCGAGGAAAGACGATCAAGAGCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002518.3-976s21c1
Sequence:CCGGTCGTCTGGCAACACCACAATTCTCGAGAATTGTGGTGTTGCCAGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002518.3-1083s21c1
Sequence:CCGGACAGAGCACCTCCAATCATAGCTCGAGCTATGATTGGAGGTGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008719
NPAS2 MISSION shRNA Bacterial Glycerol Stock
neuronal PAS domain protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008719.1-3027s1c1
Sequence:CCGGCCAGCAGCCATCAGGGTAATACTCGAGTATTACCCTGATGGCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-1272s1c1
Sequence:CCGGCCCGCAGTTCTTAAAGGAAATCTCGAGATTTCCTTTAAGAACTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-975s1c1
Sequence:CCGGGCAAGAACATTCCGAAGTTTACTCGAGTAAACTTCGGAATGTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-2380s1c1
Sequence:CCGGCTCCGAGAATCGAATGTGATACTCGAGTATCACATTCGATTCTCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-2379s1c1
Sequence:CCGGGCTCCGAGAATCGAATGTGATCTCGAGATCACATTCGATTCTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008719
NPAS2 MISSION shRNA shRNA Plasmid DNA
neuronal PAS domain protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008719.1-3027s1c1
Sequence:CCGGCCAGCAGCCATCAGGGTAATACTCGAGTATTACCCTGATGGCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-1272s1c1
Sequence:CCGGCCCGCAGTTCTTAAAGGAAATCTCGAGATTTCCTTTAAGAACTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-975s1c1
Sequence:CCGGGCAAGAACATTCCGAAGTTTACTCGAGTAAACTTCGGAATGTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-2380s1c1
Sequence:CCGGCTCCGAGAATCGAATGTGATACTCGAGTATCACATTCGATTCTCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-2379s1c1
Sequence:CCGGGCTCCGAGAATCGAATGTGATCTCGAGATCACATTCGATTCTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008719
NPAS2 MISSION shRNA Lentiviral Transduction Particles
neuronal PAS domain protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008719.1-3027s1c1
Sequence:CCGGCCAGCAGCCATCAGGGTAATACTCGAGTATTACCCTGATGGCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-1272s1c1
Sequence:CCGGCCCGCAGTTCTTAAAGGAAATCTCGAGATTTCCTTTAAGAACTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-975s1c1
Sequence:CCGGGCAAGAACATTCCGAAGTTTACTCGAGTAAACTTCGGAATGTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-2380s1c1
Sequence:CCGGCTCCGAGAATCGAATGTGATACTCGAGTATCACATTCGATTCTCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008719.1-2379s1c1
Sequence:CCGGGCTCCGAGAATCGAATGTGATCTCGAGATCACATTCGATTCTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)