EMAIL THIS PAGE TO A FRIEND

NPAS3

neuronal PAS domain protein 3

119 Gene Product Result for
Synonyms: MOP6 PASD6 bHLHe12
Gene ID:
Human(64067) Summary: This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(27386) neuronal PAS domain protein 3
Rat(299016) neuronal PAS domain protein 3
domestic guinea pig(100713384) neuronal PAS domain protein 3
naked mole-rat(101719130) neuronal PAS domain protein 3
sheep(101103016) neuronal PAS domain protein 3
Zebrafish(570491) neuronal PAS domain protein 3
cow(527053) neuronal PAS domain protein 3
domestic cat(101082067) neuronal PAS domain protein 3
dog(100688457) neuronal PAS domain protein 3
chicken(423315) neuronal PAS domain protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA002892 Anti-NPAS3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB3500354 Anti-NPAS3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900748 Anti-NPAS3 antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB2900887 Anti-NPAS3 antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry pricing
SAB3500962 Anti-NPAS3 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022123 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMNC009071 MISSION® Long Non-Coding esiRNA AK015189 targeting mouse mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022123 Rosetta Predictions human pricing
NM_173159 Rosetta Predictions human pricing
NM_001106727 Rosetta Predictions rat pricing
NM_013780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234161 predicted 1185
2 SASI_Hs01_00234162 predicted 945
3 SASI_Hs01_00234164 predicted 1256
4 SASI_Hs01_00234165 predicted 730
5 SASI_Hs01_00234166 predicted 813
6 SASI_Hs02_00355520 predicted 985
7 SASI_Hs01_00234167 predicted 1169
8 SASI_Hs01_00234168 predicted 1184
9 SASI_Hs01_00234169 predicted 1051
10 SASI_Hs01_00234170 predicted 1070
11 SASI_Hs01_00234163 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245021 predicted 1168
2 SASI_Hs01_00245022 predicted 927
3 SASI_Hs01_00245024 predicted 1246
4 SASI_Hs01_00245025 predicted 709
5 SASI_Hs01_00245026 predicted 797
6 SASI_Hs02_00368129 predicted 960
7 SASI_Hs01_00245027 predicted 1153
8 SASI_Hs01_00245028 predicted 1166
9 SASI_Hs01_00245029 predicted 1030
10 SASI_Hs01_00245030 predicted 1047
11 SASI_Hs01_00245023 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221798 predicted 217
2 SASI_Rn02_00221799 predicted 217
3 SASI_Rn02_00221800 predicted 225
4 SASI_Rn02_00221801 predicted 217
5 SASI_Rn02_00221802 predicted 249
6 SASI_Rn02_00221803 predicted 223
7 SASI_Rn02_00221804 predicted 219
8 SASI_Rn02_00221805 predicted 417
9 SASI_Rn02_00221806 predicted 170
10 SASI_Rn02_00221807 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128857 predicted 858
2 SASI_Mm01_00128858 predicted 496
3 SASI_Mm01_00128859 predicted 1301
4 SASI_Mm02_00322731 predicted 1974
5 SASI_Mm01_00128861 predicted 297
6 SASI_Mm02_00322732 predicted 1427
7 SASI_Mm02_00322733 predicted 449
8 SASI_Mm01_00128862 predicted 815
9 SASI_Mm01_00128863 predicted 384
10 SASI_Mm02_00322734 predicted 2716
11 SASI_Mm01_00128856 predicted 986
12 SASI_Mm01_00128860 predicted 2520
13 SASI_Mm01_00128864 predicted 2028
14 SASI_Mm01_00128865 predicted 842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013780
NPAS3 MISSION shRNA Bacterial Glycerol Stock
neuronal PAS domain protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013780.2-301s21c1
Sequence:CCGGATCCGACTTACAATTAGTTATCTCGAGATAACTAATTGTAAGTCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013780.2-1348s21c1
Sequence:CCGGATTGCGCAACTCCCGCATTTGCTCGAGCAAATGCGGGAGTTGCGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013780.2-57s21c1
Sequence:CCGGCTCCTACCAGCAGCGAATAACCTCGAGGTTATTCGCTGCTGGTAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1087s1c1
Sequence:CCGGCCTGTAGACATCGTAGGGAAACTCGAGTTTCCCTACGATGTCTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1212s1c1
Sequence:CCGGGCAGAAGAATGGAGGCTACATCTCGAGATGTAGCCTCCATTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1428s1c1
Sequence:CCGGCTCAGGTATTACAGAGGACAACTCGAGTTGTCCTCTGTAATACCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1086s1c1
Sequence:CCGGCCCTGTAGACATCGTAGGGAACTCGAGTTCCCTACGATGTCTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-95s1c1
Sequence:CCGGCCAACCAATCAGAATGTAGGACTCGAGTCCTACATTCTGATTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013780
NPAS3 MISSION shRNA shRNA Plasmid DNA
neuronal PAS domain protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013780.2-301s21c1
Sequence:CCGGATCCGACTTACAATTAGTTATCTCGAGATAACTAATTGTAAGTCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013780.2-1348s21c1
Sequence:CCGGATTGCGCAACTCCCGCATTTGCTCGAGCAAATGCGGGAGTTGCGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013780.2-57s21c1
Sequence:CCGGCTCCTACCAGCAGCGAATAACCTCGAGGTTATTCGCTGCTGGTAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1087s1c1
Sequence:CCGGCCTGTAGACATCGTAGGGAAACTCGAGTTTCCCTACGATGTCTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1212s1c1
Sequence:CCGGGCAGAAGAATGGAGGCTACATCTCGAGATGTAGCCTCCATTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1428s1c1
Sequence:CCGGCTCAGGTATTACAGAGGACAACTCGAGTTGTCCTCTGTAATACCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1086s1c1
Sequence:CCGGCCCTGTAGACATCGTAGGGAACTCGAGTTCCCTACGATGTCTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-95s1c1
Sequence:CCGGCCAACCAATCAGAATGTAGGACTCGAGTCCTACATTCTGATTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013780
NPAS3 MISSION shRNA Lentiviral Transduction Particles
neuronal PAS domain protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013780.2-301s21c1
Sequence:CCGGATCCGACTTACAATTAGTTATCTCGAGATAACTAATTGTAAGTCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013780.2-1348s21c1
Sequence:CCGGATTGCGCAACTCCCGCATTTGCTCGAGCAAATGCGGGAGTTGCGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013780.2-57s21c1
Sequence:CCGGCTCCTACCAGCAGCGAATAACCTCGAGGTTATTCGCTGCTGGTAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1087s1c1
Sequence:CCGGCCTGTAGACATCGTAGGGAAACTCGAGTTTCCCTACGATGTCTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1212s1c1
Sequence:CCGGGCAGAAGAATGGAGGCTACATCTCGAGATGTAGCCTCCATTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1428s1c1
Sequence:CCGGCTCAGGTATTACAGAGGACAACTCGAGTTGTCCTCTGTAATACCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-1086s1c1
Sequence:CCGGCCCTGTAGACATCGTAGGGAACTCGAGTTCCCTACGATGTCTACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013780.1-95s1c1
Sequence:CCGGCCAACCAATCAGAATGTAGGACTCGAGTCCTACATTCTGATTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022123
VALIDATED
NPAS3 MISSION shRNA Bacterial Glycerol Stock
neuronal PAS domain protein 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-1164s21c1
Sequence:CCGGTGCAGAAGAACGGAGGATATACTCGAGTATATCCTCCGTTCTTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-1198s21c1
Sequence:CCGGCAGTGCCACCATAGCTATTAACTCGAGTTAATAGCTATGGTGGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-237s21c1
Sequence:CCGGTCGACAAGGCATCCATCATTCCTCGAGGAATGATGGATGCCTTGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022123.2-2924s21c1
Sequence:CCGGTGACTTATTCTTTCGTGTAAACTCGAGTTTACACGAAAGAATAAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-386s21c1
Sequence:CCGGGCACTAGCCATTGAAGTATTTCTCGAGAAATACTTCAATGGCTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022123.2-3167s21c1
Sequence:CCGGTGGAAAGAGACAAGCATAAACCTCGAGGTTTATGCTTGTCTCTTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-337s21c1
Sequence:CCGGTCCACCTAACACATCAGTAAACTCGAGTTTACTGATGTGTTAGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-1372s21c1
Sequence:CCGGTAAAGACACCTCAGGTATTACCTCGAGGTAATACCTGAGGTGTCTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-985s1c1
Sequence:CCGGCGAGTAAATATGGACCTCAATCTCGAGATTGAGGTCCATATTTACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022123.1-1939s1c1
Sequence:CCGGGAACCCATCAATTTCGACAATCTCGAGATTGTCGAAATTGATGGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-2527s1c1
Sequence:CCGGGCTGTTAACTTCGTGGACGTTCTCGAGAACGTCCACGAAGTTAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-807s1c1
Sequence:CCGGGCACATCAAATCATCAGGATACTCGAGTATCCTGATGATTTGATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-260s1c1
Sequence:CCGGCCATCATTCGACTTACAATTACTCGAGTAATTGTAAGTCGAATGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022123
VALIDATED
NPAS3 MISSION shRNA shRNA Plasmid DNA
neuronal PAS domain protein 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-1164s21c1
Sequence:CCGGTGCAGAAGAACGGAGGATATACTCGAGTATATCCTCCGTTCTTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-1198s21c1
Sequence:CCGGCAGTGCCACCATAGCTATTAACTCGAGTTAATAGCTATGGTGGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-237s21c1
Sequence:CCGGTCGACAAGGCATCCATCATTCCTCGAGGAATGATGGATGCCTTGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022123.2-2924s21c1
Sequence:CCGGTGACTTATTCTTTCGTGTAAACTCGAGTTTACACGAAAGAATAAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-386s21c1
Sequence:CCGGGCACTAGCCATTGAAGTATTTCTCGAGAAATACTTCAATGGCTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022123.2-3167s21c1
Sequence:CCGGTGGAAAGAGACAAGCATAAACCTCGAGGTTTATGCTTGTCTCTTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-337s21c1
Sequence:CCGGTCCACCTAACACATCAGTAAACTCGAGTTTACTGATGTGTTAGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-1372s21c1
Sequence:CCGGTAAAGACACCTCAGGTATTACCTCGAGGTAATACCTGAGGTGTCTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-985s1c1
Sequence:CCGGCGAGTAAATATGGACCTCAATCTCGAGATTGAGGTCCATATTTACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022123.1-1939s1c1
Sequence:CCGGGAACCCATCAATTTCGACAATCTCGAGATTGTCGAAATTGATGGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-2527s1c1
Sequence:CCGGGCTGTTAACTTCGTGGACGTTCTCGAGAACGTCCACGAAGTTAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-807s1c1
Sequence:CCGGGCACATCAAATCATCAGGATACTCGAGTATCCTGATGATTTGATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-260s1c1
Sequence:CCGGCCATCATTCGACTTACAATTACTCGAGTAATTGTAAGTCGAATGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022123
VALIDATED
NPAS3 MISSION shRNA Lentiviral Transduction Particles
neuronal PAS domain protein 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-1164s21c1
Sequence:CCGGTGCAGAAGAACGGAGGATATACTCGAGTATATCCTCCGTTCTTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-1198s21c1
Sequence:CCGGCAGTGCCACCATAGCTATTAACTCGAGTTAATAGCTATGGTGGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-237s21c1
Sequence:CCGGTCGACAAGGCATCCATCATTCCTCGAGGAATGATGGATGCCTTGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022123.2-2924s21c1
Sequence:CCGGTGACTTATTCTTTCGTGTAAACTCGAGTTTACACGAAAGAATAAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-386s21c1
Sequence:CCGGGCACTAGCCATTGAAGTATTTCTCGAGAAATACTTCAATGGCTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022123.2-3167s21c1
Sequence:CCGGTGGAAAGAGACAAGCATAAACCTCGAGGTTTATGCTTGTCTCTTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-337s21c1
Sequence:CCGGTCCACCTAACACATCAGTAAACTCGAGTTTACTGATGTGTTAGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022123.2-1372s21c1
Sequence:CCGGTAAAGACACCTCAGGTATTACCTCGAGGTAATACCTGAGGTGTCTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-985s1c1
Sequence:CCGGCGAGTAAATATGGACCTCAATCTCGAGATTGAGGTCCATATTTACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022123.1-1939s1c1
Sequence:CCGGGAACCCATCAATTTCGACAATCTCGAGATTGTCGAAATTGATGGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-2527s1c1
Sequence:CCGGGCTGTTAACTTCGTGGACGTTCTCGAGAACGTCCACGAAGTTAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-807s1c1
Sequence:CCGGGCACATCAAATCATCAGGATACTCGAGTATCCTGATGATTTGATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022123.1-260s1c1
Sequence:CCGGCCATCATTCGACTTACAATTACTCGAGTAATTGTAAGTCGAATGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)