EMAIL THIS PAGE TO A FRIEND

NPB

neuropeptide B

52 Gene Product Result for
Synonyms: L7 PPL7 PPNPB
UniProtKB ID: Q8NG41, A0AUX9, A6NJD6, B9EJC3
Gene ID:
Human(256933) Summary: Neuropeptide B (NPB) is an endogenous peptide ligand for G protein-coupled receptor-7 (GPR7; MIM 600730).[supplied by OMIM, Apr 2004]
Mouse(208990) neuropeptide B
Rat(259222) neuropeptide B
Zebrafish(563766) neuropeptide B
cow(280880) neuropeptide B
naked mole-rat(101714803) neuropeptide B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153288 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153288 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153288 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_148896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148896 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_148896 Rosetta Predictions human pricing
NM_153293 Rosetta Predictions rat pricing
NM_153288 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130831 predicted 309
2 SASI_Hs01_00130836 predicted 316
3 SASI_Hs02_00365609 predicted 316
4 SASI_Hs02_00365610 predicted 299
5 SASI_Hs01_00130832 predicted 52
6 SASI_Hs01_00130833 predicted 233
7 SASI_Hs01_00130834 predicted 49
8 SASI_Hs01_00130835 predicted 241
9 SASI_Hs01_00130837 predicted 235
10 SASI_Hs01_00130838 predicted 55
11 SASI_Hs01_00130839 predicted 28
12 SASI_Hs01_00130840 predicted 62
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081315 predicted 203
2 SASI_Rn02_00268936 predicted 265
3 SASI_Rn01_00081316 predicted 284
4 SASI_Rn01_00081317 predicted 68
5 SASI_Rn01_00081319 predicted 47
6 SASI_Rn01_00081321 predicted 77
7 SASI_Rn01_00081322 predicted 183
8 SASI_Rn01_00081323 predicted 45
9 SASI_Rn01_00081324 predicted 140
10 SASI_Rn02_00268937 predicted 297
11 SASI_Rn01_00081318 predicted 286
12 SASI_Rn01_00081320 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185772 predicted 210
2 SASI_Mm02_00343128 predicted 205
3 SASI_Mm02_00343129 predicted 214
4 SASI_Mm02_00343130 predicted 316
5 SASI_Mm02_00343131 predicted 253
6 SASI_Mm02_00343132 predicted 257
7 SASI_Mm02_00343133 predicted 213
8 SASI_Mm02_00343134 predicted 322
9 SASI_Mm02_00343135 predicted 317
10 SASI_Mm01_00185780 predicted 205
11 SASI_Mm01_00185773 predicted 189
12 SASI_Mm01_00185774 predicted 292
13 SASI_Mm01_00185775 predicted 233
14 SASI_Mm01_00185776 predicted 52
15 SASI_Mm01_00185777 predicted 305
16 SASI_Mm01_00185778 predicted 146
17 SASI_Mm01_00185779 predicted 316
18 SASI_Mm01_00185781 predicted 131
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153288
NPB MISSION shRNA Bacterial Glycerol Stock
neuropeptide B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-216s21c1
Sequence:CCGGACCGGACCTCTGCGCAATTTACTCGAGTAAATTGCGCAGAGGTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-357s21c1
Sequence:CCGGTTGTCGCTGCACGAGACTGATCTCGAGATCAGTCTCGTGCAGCGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-324s21c1
Sequence:CCGGCGAGGGACTTTCCAGTGTAAACTCGAGTTTACACTGGAAAGTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-153s21c1
Sequence:CCGGCTGTCGAGTTTCCACAGGTTCCTCGAGGAACCTGTGGAAACTCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-261s21c1
Sequence:CCGGCTTGCCCTGTGTGTCAAAGATCTCGAGATCTTTGACACACAGGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153288
NPB MISSION shRNA shRNA Plasmid DNA
neuropeptide B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-216s21c1
Sequence:CCGGACCGGACCTCTGCGCAATTTACTCGAGTAAATTGCGCAGAGGTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-357s21c1
Sequence:CCGGTTGTCGCTGCACGAGACTGATCTCGAGATCAGTCTCGTGCAGCGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-324s21c1
Sequence:CCGGCGAGGGACTTTCCAGTGTAAACTCGAGTTTACACTGGAAAGTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-153s21c1
Sequence:CCGGCTGTCGAGTTTCCACAGGTTCCTCGAGGAACCTGTGGAAACTCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-261s21c1
Sequence:CCGGCTTGCCCTGTGTGTCAAAGATCTCGAGATCTTTGACACACAGGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153288
NPB MISSION shRNA Lentiviral Transduction Particles
neuropeptide B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-216s21c1
Sequence:CCGGACCGGACCTCTGCGCAATTTACTCGAGTAAATTGCGCAGAGGTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-357s21c1
Sequence:CCGGTTGTCGCTGCACGAGACTGATCTCGAGATCAGTCTCGTGCAGCGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-324s21c1
Sequence:CCGGCGAGGGACTTTCCAGTGTAAACTCGAGTTTACACTGGAAAGTCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-153s21c1
Sequence:CCGGCTGTCGAGTTTCCACAGGTTCCTCGAGGAACCTGTGGAAACTCGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153288.3-261s21c1
Sequence:CCGGCTTGCCCTGTGTGTCAAAGATCTCGAGATCTTTGACACACAGGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148896
NPB MISSION shRNA Bacterial Glycerol Stock
neuropeptide B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-356s21c1
Sequence:CCGGCCAAACCTGCAGAGGTGCGAGCTCGAGCTCGCACCTCTGCAGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-392s21c1
Sequence:CCGGCGCGGGACCTACCAGTGCAAGCTCGAGCTTGCACTGGTAGGTCCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-403s21c1
Sequence:CCGGCCAGTGCAAGGCGAACGTCTTCTCGAGAAGACGTTCGCCTTGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-420s21c1
Sequence:CCGGTCTTCCTGTCCCTGCGCGCAGCTCGAGCTGCGCGCAGGGACAGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-173s21c1
Sequence:CCGGGGGCACAGCTCCTACTCGGTGCTCGAGCACCGAGTAGGAGCTGTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148896
NPB MISSION shRNA shRNA Plasmid DNA
neuropeptide B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-356s21c1
Sequence:CCGGCCAAACCTGCAGAGGTGCGAGCTCGAGCTCGCACCTCTGCAGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-392s21c1
Sequence:CCGGCGCGGGACCTACCAGTGCAAGCTCGAGCTTGCACTGGTAGGTCCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-403s21c1
Sequence:CCGGCCAGTGCAAGGCGAACGTCTTCTCGAGAAGACGTTCGCCTTGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-420s21c1
Sequence:CCGGTCTTCCTGTCCCTGCGCGCAGCTCGAGCTGCGCGCAGGGACAGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-173s21c1
Sequence:CCGGGGGCACAGCTCCTACTCGGTGCTCGAGCACCGAGTAGGAGCTGTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148896
NPB MISSION shRNA Lentiviral Transduction Particles
neuropeptide B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-356s21c1
Sequence:CCGGCCAAACCTGCAGAGGTGCGAGCTCGAGCTCGCACCTCTGCAGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-392s21c1
Sequence:CCGGCGCGGGACCTACCAGTGCAAGCTCGAGCTTGCACTGGTAGGTCCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-403s21c1
Sequence:CCGGCCAGTGCAAGGCGAACGTCTTCTCGAGAAGACGTTCGCCTTGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-420s21c1
Sequence:CCGGTCTTCCTGTCCCTGCGCGCAGCTCGAGCTGCGCGCAGGGACAGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148896.3-173s21c1
Sequence:CCGGGGGCACAGCTCCTACTCGGTGCTCGAGCACCGAGTAGGAGCTGTGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)