EMAIL THIS PAGE TO A FRIEND

NPBWR2

neuropeptides B/W receptor 2

19 Gene Product Result for
Synonyms: GPR8
UniProtKB ID: P48146, Q6NWQ6, Q9H4K3
Gene ID:
Human(2832) Summary: The protein encoded by this gene is an integral membrane protein and G protein-coupled receptor. The encoded protein is similar in sequence to another G protein-coupled receptor (GPR7), and it is structurally similar to opioid and somatostatin receptors. This protein binds neuropeptides B and W. This gene is intronless and is expressed primarily in the frontal cortex of the brain. [provided by RefSeq, Jul 2008]
domestic cat(101094010) neuropeptides B/W receptor 2
cow(281208) neuropeptides B/W receptor 2
sheep(101107300) neuropeptides B/W receptor 2
domestic guinea pig(100714355) neuropeptides B/W receptor 2
naked mole-rat(101708032) neuropeptides B/W receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900479 Anti-NPBWR2 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB2900626 Anti-NPBWR2 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005286 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005286 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145288 predicted 382
2 SASI_Hs01_00145289 predicted 679
3 SASI_Hs01_00145290 predicted 522
4 SASI_Hs01_00145291 predicted 737
5 SASI_Hs01_00145292 predicted 534
6 SASI_Hs01_00145293 predicted 289
7 SASI_Hs01_00145294 predicted 283
8 SASI_Hs01_00145295 predicted 403
9 SASI_Hs01_00145296 predicted 450
10 SASI_Hs01_00145297 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005286
NPBWR2 MISSION shRNA Bacterial Glycerol Stock
neuropeptides B/W receptor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005286.2-366s1c1
Sequence:CCGGCGTCGACCACTACAACATCTTCTCGAGAAGATGTTGTAGTGGTCGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005286.2-543s1c1
Sequence:CCGGCTTCTCTTTCGCTGGCGTCTACTCGAGTAGACGCCAGCGAAAGAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-189s21c1
Sequence:CCGGCACGGCCGTCATCCTTGTAATCTCGAGATTACAAGGATGACGGCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-532s21c1
Sequence:CCGGGTTCTGCCCTTCTTCTCTTTCCTCGAGGAAAGAGAAGAAGGGCAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005286.2-194s1c1
Sequence:CCGGCCGTCATCCTTGTAATCCTAACTCGAGTTAGGATTACAAGGATGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-365s21c1
Sequence:CCGGCCGTCGACCACTACAACATCTCTCGAGAGATGTTGTAGTGGTCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-68s21c1
Sequence:CCGGCCAACGTCTCTCAGGACAATGCTCGAGCATTGTCCTGAGAGACGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005286
NPBWR2 MISSION shRNA shRNA Plasmid DNA
neuropeptides B/W receptor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005286.2-366s1c1
Sequence:CCGGCGTCGACCACTACAACATCTTCTCGAGAAGATGTTGTAGTGGTCGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005286.2-543s1c1
Sequence:CCGGCTTCTCTTTCGCTGGCGTCTACTCGAGTAGACGCCAGCGAAAGAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-189s21c1
Sequence:CCGGCACGGCCGTCATCCTTGTAATCTCGAGATTACAAGGATGACGGCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-532s21c1
Sequence:CCGGGTTCTGCCCTTCTTCTCTTTCCTCGAGGAAAGAGAAGAAGGGCAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005286.2-194s1c1
Sequence:CCGGCCGTCATCCTTGTAATCCTAACTCGAGTTAGGATTACAAGGATGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-365s21c1
Sequence:CCGGCCGTCGACCACTACAACATCTCTCGAGAGATGTTGTAGTGGTCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-68s21c1
Sequence:CCGGCCAACGTCTCTCAGGACAATGCTCGAGCATTGTCCTGAGAGACGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005286
NPBWR2 MISSION shRNA Lentiviral Transduction Particles
neuropeptides B/W receptor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005286.2-366s1c1
Sequence:CCGGCGTCGACCACTACAACATCTTCTCGAGAAGATGTTGTAGTGGTCGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005286.2-543s1c1
Sequence:CCGGCTTCTCTTTCGCTGGCGTCTACTCGAGTAGACGCCAGCGAAAGAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-189s21c1
Sequence:CCGGCACGGCCGTCATCCTTGTAATCTCGAGATTACAAGGATGACGGCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-532s21c1
Sequence:CCGGGTTCTGCCCTTCTTCTCTTTCCTCGAGGAAAGAGAAGAAGGGCAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005286.2-194s1c1
Sequence:CCGGCCGTCATCCTTGTAATCCTAACTCGAGTTAGGATTACAAGGATGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-365s21c1
Sequence:CCGGCCGTCGACCACTACAACATCTCTCGAGAGATGTTGTAGTGGTCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005286.2-68s21c1
Sequence:CCGGCCAACGTCTCTCAGGACAATGCTCGAGCATTGTCCTGAGAGACGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)