EMAIL THIS PAGE TO A FRIEND

NPDC1

neural proliferation, differentiation and control, 1

43 Gene Product Result for
Synonyms: CAB CAB- CAB-1 CAB1 NPDC-1
UniProtKB ID: Q9NQX5, Q5SPY8, Q9BTD6, Q9BXT3, Q9NQS2, Q9Y434
Gene ID:
Mouse(18146) neural proliferation, differentiation and control 1
Rat(296562) neural proliferation, differentiation and control, 1
Zebrafish(794093) neural proliferation, differentiation and control, 1
dog(480668) neural proliferation, differentiation and control, 1
domestic cat(101100346) neural proliferation, differentiation and control, 1
cow(100125919) neural proliferation, differentiation and control, 1
chicken(770620) neural proliferation, differentiation and control, 1
domestic guinea pig(100717109) neural proliferation, differentiation and control, 1
naked mole-rat(101696373) neural proliferation, differentiation and control, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015392 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015392 Rosetta Predictions human pricing
NM_001004231 Rosetta Predictions rat pricing
NM_008721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102690 predicted 937
2 SASI_Hs01_00102691 predicted 1063
3 SASI_Hs01_00102693 predicted 996
4 SASI_Hs01_00102695 predicted 862
5 SASI_Hs01_00102696 predicted 838
6 SASI_Hs01_00102697 predicted 1060
7 SASI_Hs01_00102698 predicted 949
8 SASI_Hs01_00102699 predicted 957
9 SASI_Hs02_00347747 predicted 965
10 SASI_Hs02_00347748 predicted 976
11 SASI_Hs01_00102692 predicted 543
12 SASI_Hs01_00102694 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097998 predicted 707
2 SASI_Rn01_00097999 predicted 520
3 SASI_Rn01_00098000 predicted 897
4 SASI_Rn01_00098001 predicted 806
5 SASI_Rn01_00098002 predicted 809
6 SASI_Rn01_00098003 predicted 204
7 SASI_Rn01_00098004 predicted 971
8 SASI_Rn01_00098005 predicted 922
9 SASI_Rn01_00098006 predicted 917
10 SASI_Rn01_00098007 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116293 predicted 314
2 SASI_Mm01_00116294 predicted 916
3 SASI_Mm02_00314560 predicted 750
4 SASI_Mm01_00116296 predicted 629
5 SASI_Mm02_00314561 predicted 918
6 SASI_Mm01_00116299 predicted 796
7 SASI_Mm01_00116300 predicted 720
8 SASI_Mm02_00314562 predicted 445
9 SASI_Mm01_00116301 predicted 988
10 SASI_Mm01_00116302 predicted 509
11 SASI_Mm01_00116295 predicted 1042
12 SASI_Mm01_00116297 predicted 983
13 SASI_Mm01_00116298 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008721
VALIDATED
NPDC1 MISSION shRNA Bacterial Glycerol Stock
neural proliferation, differentiation and control, 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008721.3-875s21c1
Sequence:CCGGCTTCACCTTCAACACCACGAACTCGAGTTCGTGGTGTTGAAGGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008721.3-926s21c1
Sequence:CCGGGTGCTGAGATGTATCATTATCCTCGAGGATAATGATACATCTCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008721.3-1036s21c1
Sequence:CCGGGATGGCGACTTCACTGTGTATCTCGAGATACACAGTGAAGTCGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008721.3-453s21c1
Sequence:CCGGACTGGAAGAGGAGATCGATTCCTCGAGGAATCGATCTCCTCTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008721.3-1098s21c1
Sequence:CCGGCAACCCACTGTTTGACCATTCCTCGAGGAATGGTCAAACAGTGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008721.2-1319s1c1
Sequence:CCGGCTCCGCCTTATGTGGTTCTTTCTCGAGAAAGAACCACATAAGGCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008721.2-875s1c1
Sequence:CCGGCTTCACCTTCAACACCACGAACTCGAGTTCGTGGTGTTGAAGGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008721.2-1035s1c1
Sequence:CCGGAGATGGCGACTTCACTGTGTACTCGAGTACACAGTGAAGTCGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008721.2-623s1c1
Sequence:CCGGCCTCTACTCATGGAACCTCTTCTCGAGAAGAGGTTCCATGAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008721.2-1036s1c1
Sequence:CCGGGATGGCGACTTCACTGTGTATCTCGAGATACACAGTGAAGTCGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008721
VALIDATED
NPDC1 MISSION shRNA shRNA Plasmid DNA
neural proliferation, differentiation and control, 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008721.3-875s21c1
Sequence:CCGGCTTCACCTTCAACACCACGAACTCGAGTTCGTGGTGTTGAAGGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008721.3-926s21c1
Sequence:CCGGGTGCTGAGATGTATCATTATCCTCGAGGATAATGATACATCTCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008721.3-1036s21c1
Sequence:CCGGGATGGCGACTTCACTGTGTATCTCGAGATACACAGTGAAGTCGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008721.3-453s21c1
Sequence:CCGGACTGGAAGAGGAGATCGATTCCTCGAGGAATCGATCTCCTCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008721.3-1098s21c1
Sequence:CCGGCAACCCACTGTTTGACCATTCCTCGAGGAATGGTCAAACAGTGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008721.2-1319s1c1
Sequence:CCGGCTCCGCCTTATGTGGTTCTTTCTCGAGAAAGAACCACATAAGGCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008721.2-875s1c1
Sequence:CCGGCTTCACCTTCAACACCACGAACTCGAGTTCGTGGTGTTGAAGGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008721.2-1035s1c1
Sequence:CCGGAGATGGCGACTTCACTGTGTACTCGAGTACACAGTGAAGTCGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008721.2-623s1c1
Sequence:CCGGCCTCTACTCATGGAACCTCTTCTCGAGAAGAGGTTCCATGAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008721.2-1036s1c1
Sequence:CCGGGATGGCGACTTCACTGTGTATCTCGAGATACACAGTGAAGTCGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008721
VALIDATED
NPDC1 MISSION shRNA Lentiviral Transduction Particles
neural proliferation, differentiation and control, 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008721.3-875s21c1
Sequence:CCGGCTTCACCTTCAACACCACGAACTCGAGTTCGTGGTGTTGAAGGTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008721.3-926s21c1
Sequence:CCGGGTGCTGAGATGTATCATTATCCTCGAGGATAATGATACATCTCAGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008721.3-1036s21c1
Sequence:CCGGGATGGCGACTTCACTGTGTATCTCGAGATACACAGTGAAGTCGCCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008721.3-453s21c1
Sequence:CCGGACTGGAAGAGGAGATCGATTCCTCGAGGAATCGATCTCCTCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008721.3-1098s21c1
Sequence:CCGGCAACCCACTGTTTGACCATTCCTCGAGGAATGGTCAAACAGTGGGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008721.2-1319s1c1
Sequence:CCGGCTCCGCCTTATGTGGTTCTTTCTCGAGAAAGAACCACATAAGGCGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008721.2-875s1c1
Sequence:CCGGCTTCACCTTCAACACCACGAACTCGAGTTCGTGGTGTTGAAGGTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008721.2-1035s1c1
Sequence:CCGGAGATGGCGACTTCACTGTGTACTCGAGTACACAGTGAAGTCGCCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008721.2-623s1c1
Sequence:CCGGCCTCTACTCATGGAACCTCTTCTCGAGAAGAGGTTCCATGAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008721.2-1036s1c1
Sequence:CCGGGATGGCGACTTCACTGTGTATCTCGAGATACACAGTGAAGTCGCCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015392
NPDC1 MISSION shRNA Bacterial Glycerol Stock
neural proliferation, differentiation and control, 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-496s21c1
Sequence:CCGGACTGGAAGATGAGATTGACTTCTCGAGAAGTCAATCTCATCTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015392.2-1382s21c1
Sequence:CCGGGCACCTCTCCTGTTCGGTTTACTCGAGTAAACCGAACAGGAGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-1048s21c1
Sequence:CCGGGGAGAATGAGGACGGAGACTTCTCGAGAAGTCTCCGTCCTCATTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-540s21c1
Sequence:CCGGAGGAGTCTGGACACTCAACTCCTCGAGGAGTTGAGTGTCCAGACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-989s21c1
Sequence:CCGGCTGTGCCTGGAGCGGCATAAACTCGAGTTTATGCCGCTCCAGGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015392
NPDC1 MISSION shRNA shRNA Plasmid DNA
neural proliferation, differentiation and control, 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-496s21c1
Sequence:CCGGACTGGAAGATGAGATTGACTTCTCGAGAAGTCAATCTCATCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015392.2-1382s21c1
Sequence:CCGGGCACCTCTCCTGTTCGGTTTACTCGAGTAAACCGAACAGGAGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-1048s21c1
Sequence:CCGGGGAGAATGAGGACGGAGACTTCTCGAGAAGTCTCCGTCCTCATTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-540s21c1
Sequence:CCGGAGGAGTCTGGACACTCAACTCCTCGAGGAGTTGAGTGTCCAGACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-989s21c1
Sequence:CCGGCTGTGCCTGGAGCGGCATAAACTCGAGTTTATGCCGCTCCAGGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015392
NPDC1 MISSION shRNA Lentiviral Transduction Particles
neural proliferation, differentiation and control, 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-496s21c1
Sequence:CCGGACTGGAAGATGAGATTGACTTCTCGAGAAGTCAATCTCATCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015392.2-1382s21c1
Sequence:CCGGGCACCTCTCCTGTTCGGTTTACTCGAGTAAACCGAACAGGAGAGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-1048s21c1
Sequence:CCGGGGAGAATGAGGACGGAGACTTCTCGAGAAGTCTCCGTCCTCATTCTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-540s21c1
Sequence:CCGGAGGAGTCTGGACACTCAACTCCTCGAGGAGTTGAGTGTCCAGACTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015392.2-989s21c1
Sequence:CCGGCTGTGCCTGGAGCGGCATAAACTCGAGTTTATGCCGCTCCAGGCACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)