EMAIL THIS PAGE TO A FRIEND

NPEPL1

aminopeptidase-like 1

135 Gene Product Result for
Synonyms: bA261P9.2
Gene ID:
Mouse(228961) aminopeptidase-like 1
Rat(311671) aminopeptidase-like 1
naked mole-rat(101715758) aminopeptidase-like 1
domestic guinea pig(100731889) aminopeptidase-like 1
sheep(101102662) aminopeptidase-like 1
Zebrafish(550383) aminopeptidase-like 1
cow(507384) aminopeptidase-like 1
Horse(100056379) aminopeptidase-like 1
domestic cat(101098858) aminopeptidase-like 1
dog(485946) aminopeptidase-like 1
chicken(419314) aminopeptidase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_110411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_110411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_110411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024663 Rosetta Predictions human pricing
NM_001107806 Rosetta Predictions rat pricing
NM_213733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197061 predicted 1701
2 SASI_Hs01_00197062 predicted 1727
3 SASI_Hs01_00197063 predicted 1050
4 SASI_Hs01_00197064 predicted 446
5 SASI_Hs01_00197065 predicted 1721
6 SASI_Hs02_00357065 predicted 862
7 SASI_Hs01_00197066 predicted 641
8 SASI_Hs01_00197068 predicted 982
9 SASI_Hs01_00197069 predicted 656
10 SASI_Hs01_00197070 predicted 1886
11 SASI_Hs01_00197067 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232455 predicted 739
2 SASI_Rn02_00232456 predicted 1487
3 SASI_Rn02_00232457 predicted 1507
4 SASI_Rn02_00232458 predicted 741
5 SASI_Rn02_00232459 predicted 1471
6 SASI_Rn02_00232460 predicted 1485
7 SASI_Rn02_00232461 predicted 503
8 SASI_Rn02_00232462 predicted 353
9 SASI_Rn02_00232463 predicted 426
10 SASI_Rn02_00232464 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165524 predicted 956
2 SASI_Mm01_00165525 predicted 632
3 SASI_Mm01_00165526 predicted 296
4 SASI_Mm01_00165527 predicted 658
5 SASI_Mm01_00165528 predicted 1705
6 SASI_Mm01_00165529 predicted 1699
7 SASI_Mm01_00165530 predicted 721
8 SASI_Mm01_00165531 predicted 1717
9 SASI_Mm01_00165532 predicted 562
10 SASI_Mm01_00165533 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024663
NPEPL1 MISSION shRNA Bacterial Glycerol Stock
aminopeptidase-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-758s21c1
Sequence:CCGGGACGAGAGGATTTGGAGGAATCTCGAGATTCCTCCAAATCCTCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024663.3-1868s21c1
Sequence:CCGGGCTTGTTTCTGTTTGTTACTTCTCGAGAAGTAACAAACAGAAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-984s21c1
Sequence:CCGGGCAATCAAGCAGGGTTTCAAACTCGAGTTTGAAACCCTGCTTGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-1088s21c1
Sequence:CCGGCTCAGGGAAGACGGTGGAAATCTCGAGATTTCCACCGTCTTCCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-653s21c1
Sequence:CCGGCACACCCTGCAATGAGATGAACTCGAGTTCATCTCATTGCAGGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024663.2-1834s1c1
Sequence:CCGGGCTTGTTTCTGTTTGTTACTTCTCGAGAAGTAACAAACAGAAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-619s1c1
Sequence:CCGGCACACCCTGCAATGAGATGAACTCGAGTTCATCTCATTGCAGGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-1054s1c1
Sequence:CCGGCTCAGGGAAGACGGTGGAAATCTCGAGATTTCCACCGTCTTCCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-724s1c1
Sequence:CCGGGACGAGAGGATTTGGAGGAATCTCGAGATTCCTCCAAATCCTCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-950s1c1
Sequence:CCGGGCAATCAAGCAGGGTTTCAAACTCGAGTTTGAAACCCTGCTTGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024663
NPEPL1 MISSION shRNA shRNA Plasmid DNA
aminopeptidase-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-758s21c1
Sequence:CCGGGACGAGAGGATTTGGAGGAATCTCGAGATTCCTCCAAATCCTCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024663.3-1868s21c1
Sequence:CCGGGCTTGTTTCTGTTTGTTACTTCTCGAGAAGTAACAAACAGAAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-984s21c1
Sequence:CCGGGCAATCAAGCAGGGTTTCAAACTCGAGTTTGAAACCCTGCTTGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-1088s21c1
Sequence:CCGGCTCAGGGAAGACGGTGGAAATCTCGAGATTTCCACCGTCTTCCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-653s21c1
Sequence:CCGGCACACCCTGCAATGAGATGAACTCGAGTTCATCTCATTGCAGGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024663.2-1834s1c1
Sequence:CCGGGCTTGTTTCTGTTTGTTACTTCTCGAGAAGTAACAAACAGAAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-619s1c1
Sequence:CCGGCACACCCTGCAATGAGATGAACTCGAGTTCATCTCATTGCAGGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-1054s1c1
Sequence:CCGGCTCAGGGAAGACGGTGGAAATCTCGAGATTTCCACCGTCTTCCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-724s1c1
Sequence:CCGGGACGAGAGGATTTGGAGGAATCTCGAGATTCCTCCAAATCCTCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-950s1c1
Sequence:CCGGGCAATCAAGCAGGGTTTCAAACTCGAGTTTGAAACCCTGCTTGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024663
NPEPL1 MISSION shRNA Lentiviral Transduction Particles
aminopeptidase-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-758s21c1
Sequence:CCGGGACGAGAGGATTTGGAGGAATCTCGAGATTCCTCCAAATCCTCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024663.3-1868s21c1
Sequence:CCGGGCTTGTTTCTGTTTGTTACTTCTCGAGAAGTAACAAACAGAAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-984s21c1
Sequence:CCGGGCAATCAAGCAGGGTTTCAAACTCGAGTTTGAAACCCTGCTTGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-1088s21c1
Sequence:CCGGCTCAGGGAAGACGGTGGAAATCTCGAGATTTCCACCGTCTTCCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024663.3-653s21c1
Sequence:CCGGCACACCCTGCAATGAGATGAACTCGAGTTCATCTCATTGCAGGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024663.2-1834s1c1
Sequence:CCGGGCTTGTTTCTGTTTGTTACTTCTCGAGAAGTAACAAACAGAAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-619s1c1
Sequence:CCGGCACACCCTGCAATGAGATGAACTCGAGTTCATCTCATTGCAGGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-1054s1c1
Sequence:CCGGCTCAGGGAAGACGGTGGAAATCTCGAGATTTCCACCGTCTTCCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-724s1c1
Sequence:CCGGGACGAGAGGATTTGGAGGAATCTCGAGATTCCTCCAAATCCTCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024663.2-950s1c1
Sequence:CCGGGCAATCAAGCAGGGTTTCAAACTCGAGTTTGAAACCCTGCTTGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_110411
VALIDATED
NPEPL1 MISSION shRNA Bacterial Glycerol Stock
aminopeptidase-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110411.4-774s1c1
Sequence:CCGGGCAGCTAAAGACCAAAGGATTCTCGAGAATCCTTTGGTCTTTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110411.4-1014s1c1
Sequence:CCGGCAAGCAGGGTTTCAAAGATAACTCGAGTTATCTTTGAAACCCTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110411.4-618s1c1
Sequence:CCGGCACCTTGCAATGTTTAACCAACTCGAGTTGGTTAAACATTGCAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110411.4-1455s1c1
Sequence:CCGGCCTCTTCATTGCTTCACACATCTCGAGATGTGTGAAGCAATGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110411.4-1009s1c1
Sequence:CCGGGCCATCAAGCAGGGTTTCAAACTCGAGTTTGAAACCCTGCTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_110411
VALIDATED
NPEPL1 MISSION shRNA shRNA Plasmid DNA
aminopeptidase-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110411.4-774s1c1
Sequence:CCGGGCAGCTAAAGACCAAAGGATTCTCGAGAATCCTTTGGTCTTTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110411.4-1014s1c1
Sequence:CCGGCAAGCAGGGTTTCAAAGATAACTCGAGTTATCTTTGAAACCCTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110411.4-618s1c1
Sequence:CCGGCACCTTGCAATGTTTAACCAACTCGAGTTGGTTAAACATTGCAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110411.4-1455s1c1
Sequence:CCGGCCTCTTCATTGCTTCACACATCTCGAGATGTGTGAAGCAATGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110411.4-1009s1c1
Sequence:CCGGGCCATCAAGCAGGGTTTCAAACTCGAGTTTGAAACCCTGCTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_110411
VALIDATED
NPEPL1 MISSION shRNA Lentiviral Transduction Particles
aminopeptidase-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110411.4-774s1c1
Sequence:CCGGGCAGCTAAAGACCAAAGGATTCTCGAGAATCCTTTGGTCTTTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110411.4-1014s1c1
Sequence:CCGGCAAGCAGGGTTTCAAAGATAACTCGAGTTATCTTTGAAACCCTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110411.4-618s1c1
Sequence:CCGGCACCTTGCAATGTTTAACCAACTCGAGTTGGTTAAACATTGCAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110411.4-1455s1c1
Sequence:CCGGCCTCTTCATTGCTTCACACATCTCGAGATGTGTGAAGCAATGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110411.4-1009s1c1
Sequence:CCGGGCCATCAAGCAGGGTTTCAAACTCGAGTTTGAAACCCTGCTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)